Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000109
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status unverified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 214795
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200109
Nearest Genes
Gene Nr FlyBase ID Distance
CG3696 FBgn0086902 3147 bp
Sequence Length 2254
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer GCAGCCGTGCGGTAAGAGTGAGAG
Right Primer CCCAGGCCAACAAACACACACAGA
Template genomic
Sequence GCAGCCGTGC GGTAAGAGTG AGAGTATTTA AAAAAAAATC CCTTTTTAAC CCAGCCCAAT AACGACATCT AAAAAAACAA AGTATTGTTC ACACATAATG CACACTTTAC GTTTTGCGGT GCTGTGCACA GTTGTGTTTG CAAAGTGTCG TCACATAATA AAAACTCACA AACTTGATGG GAGGATGCAT ATATGAACGT ATATGGTAGA AATGTATGCA TGTATGCATG TGAACGAATG AATCTGGGTT TAATAACAAT CAAGTCAAGT GGCTGTGTCC GCGCTAACAG TAACTAAAAA GTACAGTTGG TTTTTGTAAG AAAAGCCACA TTCAACAGCG GCACCCAAGT CCGTCACTTA GCGCGGTCCA AACAGAGCCG AAGAGCGGCT GAAGCAAGAG AATTAGGGTA GAGTGGGGGG CGCTGGCGAA GAATAAGCAG AGCAAAGACA GATGGGCGCA GCAGCAAAAC GCGCACTCAC ACACACATAC ACAAAAATGG TAATAAAATA GGTAAAGTAA CAGCGGCAGC TGTAGCAAAA GAAGAAGCAC AATAGCAGAA AGCCATACAC AGTTTTCGGA AAAGCCAAAG AGCTTTGGTC TGCTGTTGAG AGCCATCCGC TAAAACTGAG TCTGCAACAA GCGAAAGGTA CACACAACAA CAACAAACAT CCCACAAAAG TTAGTTGGGC AAAAATTACA AACACGTCAC CGCCTTTTGA ATGTGTAACG GAACATTTAT GGCAGGCCCA TTTGGCGTTA GAGATGAGTG GAATGCGGTA GTTGCAGCAT TGACGCCAAG AAATTGATCA AAATGCATAA ACTTCGCTTA TCTAAATTTG TGTATAAAAA TAAATTGGAC AACTGTCATT GCGACTGACT GATAAACATG TGGTTTATCG TAATGATAAG AATTGCGTAA ATGCATTTTA TTCCAGTCGT ATGTTTTAAT GATTATTTTT AAGATCAAAT ATCATTTATT TATCAGTTCA ATACCCACCT GAATATTGGA TGAACCCTGA GGAAAACTCT TCCAGGGACT AAAAGACCTA ATCGGTGGAT GCATTGACAT GCAATGAGAA TAGTTTTGCA AACAGTCAGA CGGGAGAATC TGGAAGTGCA AAACTGACGC TATGTTTCCC GCTAGAACTC CGAAAACTAA AGGAAGCCGA GCACACACAC ATGTAGGACA CAAGTCCTGA CCCGATTATC GAGTTGAAAC TGTTTTATAA AATTTGCACC TGGACCTAAA CCGGATCGAA TGGATATAGA GCCGCCCATT GTGAATCTAG CAACAATAAA ACAGAGAGAA CCCCGAAAGA GCGAGAGTGG AGAGTCGCTC TCTCAAGAGC GGTGTACCGG CTGAAATCGA GCGAGCGGCG AAAACACACG ACAAAGAGAA ACGAGAGAAA AAAAAAAACA ACCCAACAAG TGAAACGAGC AAAAATTTTG TCGGCAGAGA AAAAAACAAA AAGCAAAAGC ATGGCATAGC GTACGATAAA GAGCAAACCA AAAGCAAAGC ATGTATATCA CGTGCTGCGG CAGTGGATGG GAAGGGGCAG ACGGCTGAGT GGGGGGCCGT GTGCCGGCCT TTGGCGGCAG AGCTGTCAGC GTCGTAGCCG ACAACGAATA GCATGAAAGA CAAACAGAAA GGAAAAGCGA CTGAGAGACA AAACGACAGA ACGACTGTTT CGTATAGAAA GAGAGTGGGA AACCGAGGTT GCGATGAGCC AGTCAAAACA AAAAGTGCGA AAAAGCCGAG GGAGCCAGGG CAGAAAAAGG AGAGATTAAA AAAGTTTACA AGGCTATGTA CAAATTTGAT AAGTTTATGG TAAGCAAAAC TTATGACCTA TATGAGCTGT TTCAGTCATT AGATGCAAAT ACAATTTCTA GAAAATTATG TTTACACATG TGCACTAGTA GGCAGTTTGT GAACTTTAAA TAATTACATT TTTTCGAATC GAGAAAGTTG CGCTGTGCAA TTGCTGTTGG GTGGTCATCA GATGAGAGAG ATTGCAAGGG GAAAATCGCG AAATGAAGCA ATGCAAAGAA AAGACGGCGA ATGGCGGCGA CAACATTACG GCGACAAGTA CAAAACACGT ATTATGCATG TGTGCGTGAG TTGGAGATTC GCATGATTCG TGCAAATTCG CCGCATAGTT GTTCCTGCTG TTTTATTCGC ATTCGCATAT CGTGATGCCT TTTGTTTGTA CATGTGTATC TGTATCTGCA TCTGTGTGTG TTTGTTGGCC TGGG