Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000010
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status suspicious
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 214193
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200010
Nearest Genes
Gene Nr FlyBase ID Distance
CG2657 FBgn0031209 2109 bp
Sequence Length 397
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer ACTCTTCACTCAAATGAAGCGCCGA
Right Primer TGACTCTGTGTTGGATCTGCTGGGA
Template genomic
Sequence ACTCTTCACT CAAATGAAGC GCCGATCGGC GGGAAATATT TCTAAAAGAG GATATCGTTT ACGGTGGGAA GATTAAAAAT AAAGGATCGA TCTTACTCAT CTGAAAAATT TGACTGCACC AGGTATTCGA GCTGAGCCTT TGAGCCAAGA AAGGCATAGT TCCAAAAGAA GCTCTGGGTA ACGTTGCCAA TGCCCTCATC TACGGACCCG ACAAACTCCA TTTTCTTGTA CAATCTAGAC GTCGGTATAT GGGTCGAGTT CTGGAACCAG GTCTCCCAGC CACCATTGTC TTTAAGTAAG AAGCCCAAAT ATTATATACA AATGTAGCGA GCCTAACCTT TTCTTACTCA GGGTTCCAAC GCGAAAGAAC AATCCCAGCA GATCCAACAC AGAGTCA