Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000011
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status suspicious
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 214048
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200011
Nearest Genes
Gene Nr FlyBase ID Distance
CG2657 FBgn0031209 313 bp
Sequence Length 1049
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer ATCCAGCTGGTTAGCACTACCGGA
Right Primer GCCCAAGAGTACCTCAATAAATGCCCAC
Template genomic
Sequence ATCCAGCTGG TTAGCACTAC CGGAGTGTTT GAGCCAAGTC CATCTGCATA GAGCTTGTGG GTGTAGAGTA CGTATGGGCG CTCCTGTGTG AAGCGCATTA TTTGTTACAA AAACGTATCC CTATTAAGCA ATACTCACGC GCATCGGGTC AGCCATGAGC GATTCCCCAA TAACTAGTAA ATTTACAATG TTTGAGGATA GCTCCGAAGA CAAAAAATCA CGAAGTCTCC ATTGGGTGGA CCTTGAGACA AGAACTACAC GACTTTCAGT TTGCGGGCCT AAAATCTTTC GCGTCATTAA TGGGTCCGAA AGGAAAAGAA TGTAGCTTTT GCAATTGCAA TCTATATGGC TCGTAAAACG TTTATTTTTT GCTTCGTAGT CTGCATTGAT TTCCCCGTGG TAGAAAGTAA TAGGAATAGT CTGAAAAGTA AATAAAATTG TATTCATACC CGTTATTCGT AGAGTAAAAG GGTATACGAG ATTCTTTAAA ATAAATGTTA CAAGTACAAG GGAGCGTTTT CGACTATGTA AAGTATATAC ATTCTACATA CATATTGATT CTATAAGGAT CAATAGCCAA GTCGATATGG TCCGTATGAA CGTCGAAATC CCAGGAACTA TAAAAGCTAG AAATTTGAGA TTAAGCACTC ACATTCCAAA AACAAAGACG CAGCGAATGT TTGTTAAATG ATGTAACTAA TGATTTTATG CTATATAATT TTGATATATC TGCGAGAACC TATTTAAACA CGATTACTAA CGAATGTCTG TTGCTTATAC GGATACGATA TGGCCTGATA TGGCTATCGC CCAGTTCAGG TCCATAAGGT GTACAGATTA CATGTAAATA CCTATATTGA TAAAAAATGT AGTGAACTCA TTATATAACC TTAGTTTGAT ATTTTAAATG CAATGTTCTT ATGTATTAGT GCACTAAAGG CTTCTTTCGA GCTTACCTTG AACAAATTCT CTAGAATTAA TCCGTCAGAT TTTTCCACAA AGCTATCATA ATATATGACC GGTGGGCATT TATTGAGGTA CTCTTGGGC