Note: this item is temporarily unavailable.
 
Vienna Tile Information
VT ID VT042357
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 209818
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 242357
Nearest Genes
Gene Nr FlyBase ID Distance
CG10278 FBgn0038391 6121 bp
CG3992 FBgn0003507 17685 bp
Sequence Length 2267
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AAAAGGCAAATGAAAACGAAAAAGAA
Right Primer TTTACCAGCAGCAAACATTAAAGCC
Template genomic
Sequence AAAAGGCAAA TGAAAACGAA AAAGAATAAC AATCGAAGTA ACCAATAATC TCATGCAATT AGCTATTAAT TTATATATTT TTTATAGCAT TATTATATAT TTAATGCAAT TTAAGTTTTA GTCTGGTATA TTTTTTAACA TCATATTTGC AATATTAATT TTATTTCTCT TGAGTTAATA AAAGACAATT GTCCCTGAAA TGTTCTGAAG CGAGGTTTTT ATTAACAACT TTTTCAGGGA GAGTTTTTGA CAACGTGGCG TATGCGAAAT GTCATTGAGT TGTTAAGTGT TGTTAAGTAT TTCAATTTCA ACCGTTTTCT GTATGGCTTA ACCCTGAAAG TAGACACCTT AGTTCGAATG TATGCCCTCG TAAGTATGCT ACATATTTCT ACTTTACATG TAAGGTAAAA TTATCCATAT TTTACATATT TTTTTTAACT TCATTCTATT TGTTTTGGAT CCAAAATTCC TCTGAACTTA ACCTAATGTG TGTATAAAGG TATATGAGAC CAAGTGGTTT CTTAATTATA TTTTACAAGC TAATATCACG TCAGATTAAA TGTTATTTTA TGAATGTGAT CTTTATATCG GAAATTTATA AAAAATTTAA CTTAATCTGA TTGCTAGATA AGAATAGCTG CTAATTAAAT TCTCTGCCGT TTTTGTCATG TAAGATGACT TCATATATTT ATACTTATTT AACATGTAGT TTTAAATACT TATTGACCCT TTTAGTTAGT TGGTAATACT TTTTTATTTT CTTTAAATGT GATATTAGTA CAAAAAGAGA ATTATTAGAA CAGTAGAGTA TCTAATTGTT TTTTATTAGA GAATAATGGA AAAGGGACAG CTATTCGAAA AAAGTATACT TATAGGTAGG TACTCAATGT GTACTACACA TCTTTGATAG GTGCAAAAAT TTGTTATAGA TATAAAGCGC TTATTTATGA AAAATAAGGG AATACATACA GATACACTTC AGATACATTT TAATATATTT TCTGATTTTT AGGAGATATG TAAAGTGGAT GTCCTCTACG CAGAGCCACT CTAGAATTAA GCAATTACAG GCGAGAATAA AATATCAGAG AGTGGATGTG CATATGTACA TACATATGTG TGGGGGATGT ACATATGCAC ATGCACACAT ATATGTACGT TGGGGTGGAG TAAGTGTGTA TTATATTATT TTGTGCGCCG CCATTTACGA AAGCGACATT TTCAGTGATA AGATAACGTC ACATTGCTGA GTCCCCTCCG TTCTGTCTCT GTCACACCCC CGCCTTCTCC CTCTATTTAT ATTTTTCGCT CTATTTCCTT TTTAATAAAC TTTCAGTGCG CTGGTTGCCG TTGTTGTTCT TGTTTTTTAT GGGAGTCACG CGTTACAAAA CGACAACAGC AACAAAATCT GAAAGTCATT TCATGTGGCA AAACAGTTTT TGTTTATTGC TAGGGTTGTT TGCTCGCCGA GTTGTGGGGA TCCCACAGAG AGGGTCTGTA AGGGGGTGGG TCGGTAAGCG TGGAGGTGGC GCTGGTGGGT GGCAGTGGGA GGAACGAGGT GGCTGCCTGA CTACGTGACT GTACAAAAGT TGGGTAAAGT CGCGAGTGCC GCTCGTTGAA ATGGCTCGTG CACCACTCGA GTGGTGCTGA GGTGGCTCCG TCCAGTAATT TGATTGATAC CCCTGTTGAT TAGCCGTGAA ATGAAGTCCA TTCACCATAA ATTATTTCTG TAGTCAACAT TGGGGCATTG GGGCTTCAAA ATGAATTGCA AAATGGTCGC CTTTCTTCCT GCAATTGTTA AATACCGCTA TCATGTGTTT TTCAGATGTA ATCGGTCGTT GCTCAGATAT ATACGCATAA CTTTCACTCA ACAGATTGCT AGTTTCTTCG CTACGGGTCA GGGTTTCACA ATTGAAACTT GAGCAAATAA AGAAATGATA ATGCCAAGCA TATAGCCTTG CCTTGCCCGA TATCATGAAC GATAAGATAA AGTTTGCCTA TGTTTTCGTT TTCAATTTTT CGGGACCTGT ATGTAAATGA AAAAATCACT ATGAAAAATG AAACTTTAGA AAATCCAATA GGAAGATTTG GATGGTGGTG GCAAATTTCC AAAATGGTTG ACACTAAGTA AAAACTCGTA TGGATATATG AGTAACCCTA ATTTACTTAG CCATGACAAC TTGGAATTAT TGTTTCGTAA TCATTTGGCT GAATTTGTTT ATTCTTCTTT TATAAGAGCT TAGGCTTTAA TGTTTGCTGC TGGTAAA