Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT062063
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 208191
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 262063
Nearest Genes
Gene Nr FlyBase ID Distance
CG32594 FBgn0052594 2062 bp
CG32592 FBgn0030600 34776 bp
Sequence Length 2138
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGCACATAGAGATTTATTTGAGCAGGGG
Right Primer AGATACGATGGTCGGTGGGCGA
Template genomic
Sequence CGCACATAGA GATTTATTTG AGCAGGGGAA TGAATACATA CAATTCGAAA TTGATTTTGT TATTTATTAA GCCAATATGT TTAGAATACA AATCAGAGGG CCGTTCCAAG AACTAAATCA GTAATCAATA ATCCAAATGC TCCACTTTTC CGCTCTGCAT ATACATATGT ATATACTACA TATGCACATG TATGTATATA TAGAAAAGAC ATATGACCTA AGCGTGTTTT GTGCGCTCCA ATTCAAAAAT ATATATCTTT TAGTTTTATA ATAGATGCAG ATATGCCTTA TATCGCTCTC CAAGTCATTG GATTCTGCAC TTCCTCAGCA ATTGAGTGAA CTTAGATGAT TTTTCCAGCG GATGTGGGTG ACACTTTACC CACCCCCTCG CTCCGCCACT TATCGCTTCT TTGTGAACGA TTGGTTTTGA GTATGTATGC CGCATGTGTC GTCATCTTAT ATGCATATAC AGGAATCGTA TTTATTTATT TGCTGAAAGT GAACAAACAG AAGCCGAAAG CGAAGGAAAA AAAAAACCGA GACAACTGCT CAAAACAAAA GTATTCAATC TATAGACAGT AAAAAAGACC GCTGCACTGT GAGAAAAATG TACATCAACT TGGCCACAAT TGCAAGTGCT TTATTTTTCT AGTAAATAAG AAAACTGCAA TATTTTCCAA CATTTTCTAG CTGTACAAAG AAAACGGAAT TTATGTTGGG CGCTTATTTT GGTTTCGAGT GTTTCTGCTT TAGTGGAATG CGCCTACTTA AATTCCCATT TCGAATGGCT ACTTAAACTA CTTGGAACTA CTTGGAACTA CTTGGAATGT TATGGCTGTG AGCTGCTAAA AATCTATCAA TTGCCACAAA TTGAATGCTC GTCCCACAAA AACAACAATA AACCAGCAAC AAAGTGAGAC GACAAGGAAA ATCGGAAAAG AGGAGTGTAA ATGCAATGAG CCGAACACTC AAAATCAGAA GATAGCGCTC TAGGAGGTAC ATATCTGAAT GTGCACCAAC TAAAGATACA GATACAAAAA TAGTGAGGAG AACTGTGCAC ACTATAGAAT TTTGCAAATA TTTTCGTTAA ACAACTTTCG ATTGTTTACA CAACCCACAG CCACGGAAAC CGAGTTATAC ATTTCGATAT GGAAATGGAC ACTGAATCAT TCACAAAACA TATGCACTTA ATCGATAAAA TACATATGTA TATATAGCCC ACCAAGTCAT TTGAGAGAGA AAACCAAAAG TTAAATCTTA TCTTGTCATT CTCGCCTAAT TTATACAATA TTTGTATTCG GGGTAGAAAA TTCATATGAT GTAAAAAAAA AAAAAATAAA AAAAAAATGA AGATGAGGGA AGGGAGATTT ATACTCATAA CAACTCATAA TACGATAAAC AAAGTTAGTT GTAAAATGTA AATGTAATGT AGTAAATGTT GTTTATAATC CACATTATTC GATGCAATTG GTAAACAGAA GGATATTCCA GAGATTCGAT CGACCGAATA AACATTTTCG CAGTACATTT TGATTAGAAG GGAGTGCCGT TTGCTGCACT TCAGATGACC AAAACATTTT GGAAAATGCG GTACTACAGA GAAGAAAACA TTTGACTTCA TCGCTGTTTC ATGTTATCTA AGTATTTCCT GATAGCCTTA GTCGAAAACT GAGGTAGTCT CTTATCCGAG GATTATGATT AATCGGAAAA GAAACGAATT CTTTGCCAGC GAGTCACGTA GTCGTAGTTT TCCAAACGAA CGTGTCAAGA TTGCATTATC TCGCATATAC AATACATACA GATATCACAC ATCAGATGCA CTCGCTGCAG GGCATGTGTG CCCTGGGAAA TGCTTTGGGA AAGTCCTTTC TTTTCCTCCC ATTTTGCAGC CATGTGACCA GCATGCCATT GGAATTTCGG TTTTCGGTTT TCAGTTTTCT TGGCCGCACA AAATATATAA AGAAATGAAG AGATATAGAT ACAGATACTG AAAGAGAGCG AGAGGTGGAT CATAATTTAT TTTTAATTGG CTTTGTTCGG TTATTTATGT TCTGCTGTTG GTTTTGGCAC TTCCAACCAG GCGACGGCAG CTATTTCCGC TTGTCTGCCA CGCCTTTCGC CCACCGACCA TCGTATCT