Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT004442
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 208167
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 204442
Nearest Genes
Gene Nr FlyBase ID Distance
CG18024 FBgn0029123 5670 bp
CG32986 FBgn0052986 29345 bp
Sequence Length 2170
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGCTTTCCGTTTTATTCGAATGTTATTTCTCC
Right Primer CATTTCGAATTTGCATAGAATTTTTCGGTT
Template genomic
Sequence TGCTTTCCGT TTTATTCGAA TGTTATTTCT CCGACTAATT TTTTGTGGCG CTGTCATTTG TTGCAATCAG TGAGAAAATT AAACGAAATC CCGATGACAA CATTTTTATT GCTGCTCGCT TGCCATTAAA ATTAGGAGCT AATCACACGT TTAACAAGAT TTTTTTGTTG TGTGTTTGTT TATTCGGTGG TTTCTGACTT CGATCAGTTG ATATTTTATT TTATTTTTTG TTGCCTTTAT AGTGGGGACA GCAGACAGGT GCTTAGCTTA TTTTATTTTT TTGGCTGCAT CTGAGTCAGC AATCGCCGAT CGTGAGAGTT TTTCGTTGGC TTTGTTTTGG ATCTTTTGAT TTAGTTCATT AATTGGCCAT AATAGTTTTG TTTTATAACA GGGTATACAT CGGTGGTGAA CTTGAAATCC ATTACAAACT GGTTGAAATT GTCGTCAAGT GTTAGCTTAT TTCATTTTGA ACAGTAAGCT TTGGAATAAA ATATCCATAA GTATACTCTG TGATGTTCCC TAATCAGATG TATCTAAGCT TACTCTCTCT TTCTTCGGGG GACTTCAACT TCAACCCTTC AATTGTGGCA ACAAAAGCTT TGCAAATGTC AGAAAGAGAC GACGGATGGG ATGCAGAGAT AGATGGATAG AGTTGAACAA CTAATTAAAC TTGAACAATG GCGTAAAGTT GGCAAACAAA TGTCATTACT TCGACTCCAG TCTGGTCAGT AAGTAGTAGT AGACTCTGAG TTGCTCGAGT TTTCGGTTTG CGCTGCTGGT TGACACATTT TCTGGAATGT AGGTTAACCG AGTGAGACAT GCAACGAAAT CGAGTGGATT CGTAAGCCTA AAACTGTAAC CAATTCGGAG ACGGCCCTTT TTCTACACAC ATTTTTTCGG CTACATTTCC GAGATGCGAG TACATAAACA AATCGGATTA GTTGACAAAA ATCCAATTAG CCGTGAGCCC CAAACCCAAA ACGGTTGACC ATTTTCAACT GGCAGTGGAC GTAAAAATAA CTCGAGCATT TGATGGATGT GTGGCAGGCG TAAGAATTTA TAGAGCCGTG ATTTGATCGA TAGGCCCGAT GATTTACGAG GCAGGTACTG GTGCTGGTAA ATGGTACAGG TAAATCTCTG GGGGGTGCAA CATACCATAC ATGCAAATTT TTAAATTCTC AGACTGCCTG GCGACCCCGG AGATAAGCTG ACATCCCGTA CACCTGCACC GGAAAACGGG AAAACCCATC CACCATTGGC AGGTCGATGC TCATACCTGT GAGCACGGAT AATGAACCTC TAAAATCCAC GCCTCGCAAA TCCTCAAGCG GATGCTCGGA TCCGCATCCT GGCACTCATC CTCGTTTTTG GGCAATAAAG GGCTAAACAA ACAGGCACGA CAATAAGTCC CTATAGATCG CAGTGCATAT TATCATAATC ACCAATAAAA CCCTAGTCGC AAACTAATCC ACAGCAACCC ATTTCGAACC TTCGGTTGCA TTCAGGGATT TGCGGTACAC AAGTACAACT CCGAAAAGTT TATCGGCATA ATACTGCATA CTTGCTTTCG GTATCTCAAC GATTCTTGAT ATTTCTCGAC CTCCACCCGC ATTTTCGCCT AGTGTAATTC AATCACAGAA CGCGTTCTTC CCGGGCAATG AACGCCTGCA TAAAATGCGC AATCTGAATC CCATGGGGCC ATTGGCTAAT CGCTGTCTAA TTATAATTTT GCATTTTTAT CGCTAAGGGT CTGGGCATTT TTGGGAGTTA GGGAGCGAGG AGGGAGGGGC CGGCAAGGCC GTTCTGTTTC GGATGCGGTT TGTTTTGCAA TTAGGCGATT AGTCACGCCC TGATTTGTCA TTGATACTCC GTTCGCTCGA TTGCTCAGTT TGTGCTGAGT GTTATGTGGC AGTACTAGAT GGAACCGAGG CCCTGTAACT ACATACATAT GTATATAAAC TATGCGGGCT GGCTTAGTGG TACATTTGAC ATGGGGGCGG GGTAAAATAT GCAGATAACA GGAAGGGAAC ATGATATGCG ATGCCAGAGG AAGGGTCCGT CTTTGGTGGT TTCACGTTTT GGGAGATCAT ATCGAAGTAT CTGCATAATA TCAGATTATT GTAAAATACG ACTATCACTT AACCGAAAAA TTCTATGCAA ATTCGAAATG