Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT033917
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 208050
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 233917
Nearest Genes
Gene Nr FlyBase ID Distance
CG13251 FBgn0037014 26071 bp
CG4717 FBgn0001320 29822 bp
Sequence Length 2243
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer TATTGCCTTTGCCTTAGCTGGCTGG
Right Primer ATGCAGCCAAGAGCTTTCCCAAAAA
Template genomic
Sequence TATTGCCTTT GCCTTAGCTG GCTGGCTGGG AAGGTGTGGT AAAGTGAGGT AAAGTCTGGC TACAAGCTAC AGTTACTATT GAGTCTCGCC CGTTGCCAAG TTAAAGTTCA ATGATGTCAT TACCCACTAA TTCACACCTA AGTTTTGAAT ACGCCGCATG CCGTCAGAGC TCAGGCCTTA TGCCAATCGA TCGAAATCGA GAATTATCAT TGGAGATAAA TAACATTATT TGGCCAATGG AATTGTTGTT TCGTCTTAAA AGAGAAGCTA ACGAGACAGC CAGAATTAAA CGTACAACGA AATTTGTCTA CCCCCTGGGG TGATATATTT TTTTTGTTCG TCTGCCAAAT TTAGTTCATT GATTGCTGTT AAGCGTACGT TTTGTTCGTA TAGTATAGAT ATAGATATAG ATATGTATGT TTGGTTTTTA ATGGCTTTAG GTAGCTGCCG CTGATTATCA TAAATAAAAT ATGAGTTCTG GCTAAGTTTG TTGCTTAAGT CTTTTGTTTT TTCGTGTTGG TTTCGTCCCT CCATGAAATG TCAACGAATT CGTTTACTGG CTGCTCAAAG ATAGATATTT TCATGTGAAA ATGAGTTCAG GCAATGGGTT CCACTGGCTG AGTGCCTTTC AATTGTCTAG GCCGTTCTGT TGTTGTCACT GCCAATTAAC ACCAGTTGCC CAAAAAGTTA AAAGTTAATT TAAATCAATG CGCAATCGCG AGAGCGGCAA ACTCCACTCG TGCGTCGCTG AAACAAATGC CAAATATCCA CTATGAAAAG CCCATGGATC TCGTTGGTTG GGCTCCAAAA AGTGTTAAGT ATGCCTCGTC TTTGGTTGCT TATTTTCGGT GCCCACTGTT TGCTTTGGCA ATCAGTTTGT TGATAATTTT TGTGTGTGTG CTGTCTGTTG TTTGCCATGT TTTTGTACCC TTTGTGTGTG ATAATTTAGA CAATTCGTCG ATAAAGGCGC ACAACAAGCT TCTATTTTCC TCGGCTTTTC TTTGTCTCTG CCTGTTTGAG TTGCATTTTA ATTACGTCTA ATAGGCCAAC GTACGTATTG ATTTGTCTTC TGTTTAAAGT TCCATTTAGC GGCCAAGTTA GTTAGCTTTT AGGGCCCCAT CTTTGGGTGG TCCCGTTCAC ACGGCTCTTT CTGCACATTG TCCGTTTAAG GTATTACGAG TATTCCCATG ATCCATCATC CGATCGACCT CAAGCGAGCA TTCAATCATT GTTAGTACAT CACCACCCAC CGCATAACTT TCGTACATCT GCAATAACAA CAACAACAAC ACAAATGGCC ATGTAAGGCC AATCAGCGAA AACTTGGTCA ATGGCTATAA TTGCCCGGGC CCAAGTGTTA ATGCTTCGAT TCGAATAACA GGGGAGTTTT CGGTTTCATT TGTGCAGCAT CAACAGTAAC AATAAAAACG TGATTAAAGA TGCTATGCAA AGCAATTGTT ATTCGATAAA GGGGTATCAA AGGCTAAAAT GGAAATTACA TTACTTGCAT GTTAAATATA TCCAATAAAA ATGTATCACA ATTTATAAGG AAATAATGAA TAAATCACTT TTACTAAAGC AAAAGAAAAT AGGTGATTAT AAAATAATAA AATGTGTCAA TTGTGGTCAT TAATATACAA AATTAACTAT CTATTTTAAT TCGTAGTTAG CCAATTTTAT AATTTTCGAA CGTGTAACAT AACAAGTAAG ATATATTGGT GCCTCGAATA GGGAAAAAAT AAAATTAAAA CACTCAAATA AATGAATAGC CATAAAATCG AAAATTAAAC CTAAATCTTG GCAAAACTAC CAATCGGTTT TACTTCCAGG GCATCGATAG CTCCATCATT AGCTTGGCCC CTTAATTCCA TGTTATTGAA ACGAATCACA AATCTGTTGC CTTTTGCAAA TCGCTTTGGC TGCGCTTAAT GTGGGAAAAT GTCGATGGCA GTGGGCTTCA CTTGGCTTTA CTCCGGGTTC TCGGGCTCGC CTCTGTAGCG ATGGGGCATG CCCCAAAAGC CGGGCTTCTG GCCCACTCCC AGTCTTTCCC CGATCCGTTC ACCTGACTAT TAAAATCAAA CTATCGAGCA GAGCGAGCAT ACGTCATGCA TATTATTACA ATTACAAATG TACGAATGGC ATGACAAAAA TATTTCCACA TGCATTTTTT ATGCTTCATT TCCTGTGACT GGGCATCCAA TCGATGGGAG TCCCAAAGTT TTTGGGAAAG CTCTTGGCTG CAT