Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000266
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 208021
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200266
Nearest Genes
Gene Nr FlyBase ID Distance
CG2819 FBgn0023489 2032 bp
CG2851 FBgn0010323 13232 bp
Sequence Length 2061
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CATTTGAAAACAACGAGAATTGTTGAAAAAG
Right Primer GGATCGTCTAATTGGGAATGGATTGGG
Template genomic
Sequence CATTTGAAAA CAACGAGAAT TGTTGAAAAA GAATATTTTT CGTAGTGTAC ATTTGTGAAT TTCGAAACAT TCGAATCGAA TCGAAACGAA ACGGAACGGA ACGGGTCCTT GACTACGAGC ACGGGTACCT TTTCTGGCCA GGCTCAGCCA TAGCTTCTAT GGATTCCGCA TGTGTGTGCC AAACAAAGGA ACCCCCCCCC CCTACGCCCC TGCCACGTCC CCTACCCTCT GCACACGCCT TATTTGTGGC TCGGATTAGA GGCAAGCTAG TTGTGCGATT TGAATGGATT TCGGCTTCCA GTGCTGTTTG TTCGGCAATA ACATTTGCTT TGCTTTTTAA CAATTACCAA AGACCGCTCC ACGCTCCTCC CTGACCTGCC CACTGGTTGG CTGTAATTTC CATTTACTCC TATTAACGAG GATTTCTGTA GCTCCTGATC CTAAGCATCC TCAACGAACA ACTCCTACGC TCCATTAAGT GAAAAGCTCA CAGCAGAGAT GATAAATATG GTGAAATTTA ATGAAATTGT CAGTTAGTTC TAAAGTACTA CAATAGATAT GCTATTCTCA TTACACGGCG AGATCCAGAT CACATGAGGG CATCTCGCTT GATTAAGACT CGTCCGGTTT GGCCAGAAAA GCTGGCTGGA ATTAAGCCAG AGGCTTGAGG GGAATGGAGC GGCGAAAGGC CCGACAGAGG TAAGGATTCG ATGCTGGGGG CACCCGGCTC AGCTGGCTTA ACACCTTGGC GAGCTCCTTG TGGATTTTGC GAGGCCAAGG GCCACCCAGA GACATCCAGT GGCCACCCCG TCCTCCACAC CGCCCCTGCT CGGATGCCAT TTTCCAGCTG ACAATGACAA GGACAATAAG CTAATTGAGG CTGAGGTGGC TGTGTATGGA GATGGGGATG TGGATGTGGA TGTGGATGCG GCAACGGGCG GACAGGCCGC AGACTCAAAA ACCCAACGGC ACGCTCGGCT GGCCAAAAAA GTTCATTATC CCCAGCCGAG GGTGACATGG CGGATGGCCC TTGGATGCGG ATGCGGATGA GGATGCGGAT GAGGATGAGG ATGCGACCGG TTGCTATTGG ATAATCTTCT GTTATGAGGC CGCGCAACAA TGCGCACTGA AATTCGGTTG GCTTTTTTCG AAAGTGATTG AAGAGAGGAG GAGGGCTGCT AAAAGATTTG ATACTGGTAA CAACTTTTAA GTATTTTCCC AACTCTCTAT ACATTGGACT TCTCGGCTGC CTGGCCTGGT CTGGCCATCT TATGGCTGCT GCTACTGACT GGCACATTTA AAATTAATCG AAAATCTTTT CTCCGGTATT ATTTCGAGCA CTCGCCTCTC GGGGCTGTGT GCACAAGGAC CACAAACTTT AATCGATAGT CAAATAAGCG TCGGTCCTCC GAGTAGCAAA AGGGGCAGAG TGGAGGGTGC GGAATGATTC AAGGGATACC AGCCATGTGT GTGGTACACA TGAGGACATC CTGCGAGAGA GCCGAGCTGA GAGCTGCTCC TTGCTCGGCT TTTGTGCTGT AATTTCTCTA ACGTTTGTTT ATATTTTATA TCGAATGCGC CCCGGGCCGC ATAAACGCAA TAATCGCACA TTTTATGGAT TAAACTCACC TGCTTCGCCT GCTAATCTAC GGCAGGATTC TTGCCAGCAG CCATGACGTG GGTCAGCCAC TGGTACTGGC CGGGTGGGGG AGGGTTAGAA AAATCATAAC GAAATGCTTT TGATGTCCTG CAACCAAATA ATCCAATCAG AGTGTATAAC ATATCCCCAT GGGTTTCCTC GCAACCAAAA TTCGTGGATT TTTCCAATAT ACTATAACAT AGGTAGTTAT TAAGTTATAG TTATTGGTGA CTCAGATAAA AAGGTAATTT AGAATGAGTA TCTTTTGGTT GCAAATATCT TAAATGAATA TTACTGGCCA ATCCCAGTGC CGGATCACTG CAACCTGTCA AGGCAACGAC CTTAATCCTG CCCTGCAGCG GTGCTCCAAT GTCCCATGGT AATTCCTCGA CCAGCCCAAT CCATTCCCAA TTAGACGATC C