Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000019
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207960
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200019
Nearest Genes
Gene Nr FlyBase ID Distance
CG31973 FBgn0051973 17316 bp
Sequence Length 2096
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TCGTTTGTTTTGTGCCTCTGTGGGT
Right Primer CAAAGTAATGTCGGAATGCAACAAGCAA
Template genomic
Sequence TCGTTTGTTT TGTGCCTCTG TGGGTGCTAG AAAAAAGATT GTATTTAAAT GAGTGTTTGG TTTTTTGGGA ACACATTTTG GAATCACGAG AATCACGCAG GAATATAATG TCAATTGTTC ACGTATTTTG ACGATGTGGA AAAATACAAG TTATTCCTTG TGTAAGAGTC CATGTTACTT TTTCCCTTTT CACGTAATCA TACAAAATAT GACATTAAAG TACATATGAC CAATGGCTTT TTTTGGTTGA TGGTGTTATT TCCTCAGTCG TTGTAAAAGG CCTCTTACTT AGCTCAAGAA TTTGGTACAT TAAGTAGGTA AAACAAATTT ATAGCGATGA AATAAATGGA TCCTAAGGGA CACAATATAT GATTTTTGCG AGATAGTGTC AAGGCTTCAA GTAGGCATTT AGCTTTATTT ACAATTGAGT TACCACGCTC CAAAAAGTCA TCAAGTATGC ATCTCCCTCT AGACCTCTGC TCTGATGTGA ATACTTGCTA CAGTCTGCTA TATTGACGAA TCCAATGATA TATTAACATA AATATGTACG TTGGAGGTAG ATATAAAAAT CCAATCACGT GCCAATGGTT ACTGACCATG CAAGAGAGCT AGACCTGCCA ACAGCATTTG CTATTGTGCT CGTGGCGCTG TCGCTACCAA TGCTAAGCAA TCAGACAGTC TGCTCCACTG AACAATACCA CTTTGTACGC TTCGTATTGT ACTTCGAAGC CAGATCAAAA GCTATATCTT GAATCGAAGC AAGGCATGAA AGCTCTGTTG TAACGCAGCT CGCAGTAATT CGAACACAAT CTTGACTGGT TTTGCTTGGC ATTTGTTGCT TGTGTTCGCT TAATATTTAT TACTTTATTG GTGTATCTAG GACTAATAAT AGTCCTAATA ATAACTTTGT ACTGGAAACT CTTACCTTCA GGTAATGGAG AAAGATAGCT CATGTGATCA CAGTTTTCTC TTTACCGTAC CGCGCACCGA GCAAGAAAGA CAGAATCAAA AGCCTGACAA TTCCGACCAT TGTTCGGCTT ACTCTTTTTG TATGCTATGC TATATGCATA TATACACGCG AACAACAAGC CATATACGTG GTTTGAAGAT GAACTTGACT TTTATGTCAG TCGGAAGCAA CACTTAAACA TGGTACTAAT GGCTCTTTCC CAAAGTACCG GCTCAAAAAA CAAATTTAGA TGAATAATAA TTTTGCATAT GATTGTTGCT TTGGAAATGC TGAGCTTTAA AAACCAATGA AGCTCTCCAT TATTTGTTTG TTAAAGAAAT AAAAGCCAAC TCTGCATGCT TCTATGTTTT TGTCCAGAAA ATACACAACC TTACATCGCG CGATAGCTTT CGTAGGTTTT ACTTTTTCGT GCTCAAGGCG ATAGTATATG TAAAACACAA TTTTTTTTAA TATTATACTG GGTGATGATA CCCGGTGCGA CTTAGATGTG TCACTGCTGC CTGGCCCAAA ATAGTACGAG AAATAAGATG GCTTGAAAAA GCGGCATTTC AACATCGCCT CTAAAGCCAT TAAATTGGTA ACCGCCAATA GCATGGCCAA ATTTAGACAA ATGGCGCAAA TCATTGCACT AATTGCCACC TCGTTTGGCA GCGTCAAATG GATCTTATTT ATGCCATCCT CAATGAGCTG TTAGTCAACA CTGCAGTTGG TAAAAGAGGT AGTTAGGTCA AATAACATTA AGCCTTTAAA TAAATCTGTT CAATTACGTT ACGTGGATAA AGTTGGAAGT CTTTTCAATA TTTATTTTAT TTCTTTCACT TCTAATTACT TATAAGTTGG TTAATAATAT TAGTTTAGGT CAAGATGAAT GTTGAAACTT TAATAACGGT CTTTGTTATA TTCAGTTATA TAGTCAGGGC CTGCTTGAGT GCCTTAATAA AATTTCCCTT TTTCGTGTTA CGCGTTTGAA CTTTTAATTA CACGTAGCTT GTTGTTAAAG ACTTCCATTT CACTGGGTCC GGTTCAAAAT TAAACGCGCG CCGAGCACAC CCGCCAGATA AAAATATAAA TTACTCAGTG CAAAAGCGAT CAATTCAATT GCTTGTTGCA TTCCGACATT ACTTTG