Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000013
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207874
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200013
Nearest Genes
Gene Nr FlyBase ID Distance
CG31973 FBgn0051973 31997 bp
Sequence Length 727
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CTTACGCTGCCGGCTCTTCAACTTC
Right Primer ATATTCCACGACTGCATGATTCCGC
Template genomic
Sequence CTTACGCTGC CGGCTCTTCA ACTTCATTAT CGATTCGGGA AGATCGAATT CCAGATTTTC CAGTCCAGGG GTAAATGTCG GGGCATGGTT GACACGTTTT CATGTACCGG ACGCCGGACT TGTGCCACAA ATTACACACT TTTGGGTTGT TGCAGCGTTT GGGCCGATCC TTGTTGATAT TCAATTGTTT TTTTTGGTTT TAATTGGTTT CCTGAACTAG ATTGTTAATC AACTGTGTAT ACCTACCGAA TAATCGCACT GAAATGGTTG GAATGAGTTT ATGCGTGATA TCGGTGTAGG GTCTCGCACC CATTGAAGCG CTTGCCAGTT GGTTATTATC CACACATCTT GCATTGCATT GATGGCATCA AGAAATTTAA TAAAGCCCTC TTTGTGATGG GGCTGGGTAA ACCATGCAGC GTGGTAAAAC AAGCCAAATG GTGCTCTAAA ATACATAGAT GAAGAAATTA AATAAGCCAT AGGGCCATTG TTTCAAATTT AAACCTAAAT TAAGAGTTTC AGTAGAGGTT TACCTGTTTG TAGTGTAATG ACGTTCAAAG TTCTTCATAA TCATCTTTGT CACTCCATCT GCATCACTAG GGTTGGAACA GGCATCGCCC ATAGAACAGC GGCCTCCGTT AAGGTCCTGC CACATGACCA TAGGTACCTG CCACACCCCA GGATAGGAAC GGGTCGGGCA AGGCGGAATC ATGCAGTCGT GGAATAT