Vienna Tile Information
VT ID VT054815
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207668
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 254815
Nearest Genes
Gene Nr FlyBase ID Distance
CG32816 FBgn0052816 69407 bp
Sequence Length 2161
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCTTCATTTAGCATTGGCGATTGGC
Right Primer TCCCCTCTACCTTTGTTCTGTCCCTT
Template genomic
Sequence CCTTCATTTA GCATTGGCGA TTGGCTTACA TTATCCAAAA AGTAAGAGTA TCAAACAGAG CAGAACAAGG CAATCAAAAC AGCACAACTT TGCAACGTCG TTCAGCGTTA CCGATTTATT TGAATTTCAA TAAGCCCCAA CGTTTTTGGA GTTCATTATC CTGTTATGTC GGCATTTTTG GCCTTTCATC TCGCGCATGC AACGAATTTG AACTGGGGCG TTATTGATTA GCGTTATGAA TTATTGATAA ACAACCCTCA GGGGAAAATC GCCCACACCG CAGGTAAAAA AAACACTATG CACATAAAAC AATAAATTGA AATACAGAGT ATATATAAAA ATATTCATAC TTAGCACATT TTTATATATT TTACTGTTGG CCCCATATAA CCTAAAATTA TCCGCCCAGA TATGCTTGGG CTGATATCTT TATTTTTCGG AGAGGATGCA TAAATCGCAA GCAAACGTGC CACGTTCATC ATCTGGGGAG CCAAAAGGGG AGAAATATGT TCCAATTAGC GAAGCCAAAT GTGACAGGCC ATCCACCCAG AAGAAATCAA GGCAGCGACT CAGTTTCACA GGACTCGCGG CTCGGACAGG CAAAAGTTAT TTGAGTTGTC ATATTAGGCC GTGATAAATG TAGTTACATA CCAAATGTGA TAACTCTGCC CCTGGCTTTG GATTCCCCGG ACCCTGGATT AGGTAGGCGC CTAGTTTCCC TTTCCCTTGA TGATGATCCG CAAACTGTCA GAGGTTGTTC GTCTACAGCC TGATCATTGA AAACGTATTT ATGGTACCAG GGAAATTCCT TCAGCCTTTT TGCGCCAGTT TAAAGAGCCG TGGCCCTGAC TTTTTTCTTT GCTGACCTGG TATCCCGAAG AACCTAAAAT TTCACCTGCC GGGTCAATAG GGGATTACCT GATCGTAAAA GAGGTACAAT AAGCGCGCGC GTGCCTGGAC AATTGGTAAA TCGAGTCCAA TTACTTATCA CCCTACCCAA TTTCTGTACC TTTAAGATTT TGCAGGTTTA TTTGAAAAAA TTCCAGAATT AATATAATAA TTTTTACAAC ATTTGTTTGA CCTGTTTCTT TTTCCTGAAG GCACTTAAAA TTAAATATAT CTTTTTATTG AATTTTAACA GTTTATTTGC TTTAAATAAT GAAATTATTT ACTTTTCTTA CTTATTATTC TGTAACACTT CTCGGTTTAC ATGCCGAACA AAACCTATTT CCGCTTACAG AAGTACCTTC TATTTGCGAT AGTCCGGTAA TAAGTGTAAC CACCTTCTGA GCAATTCGTC CCTTCAACAC CTCTCTACAA GTATTTTATT ATTTATGCTG CGACCGCCAG CGTCGTCTTG GGCATCCCAA TTAAGTCTCT AAGTCCACGA TAATCCCAGA AATAGTCTGG AAATAATCCC ATTAGAGTGT GCTACATAAA CACTAACAAA TGTTCTAATG GACGGTTATC CCTCTCGCAT AAGACAAGTA GTTCCCTAAA CCTAATTTCC AACAGCACTT AAAAGGATCA GAGCACAAAT TCACCCCAAG CCATGACAAC GCTAACACTC CAATATTTGG CCAACTACGT GGAATTCTCC TTTCGAAGCC CACCCAGAAA AAAGACGATC TGCACACAGA TCTTATAGTG AAATTCCGCA ACACGTAGAG CGATACGTCT GTGAAGTTTT ATGCATTATA TGAAATTTGC CCATTAACAA TCATTAATTT CCATGATATA CAGAAAAAAA ATTATATTTA AATCGAAAGG TTTGAGGTTA AAAGATAAAC TGAATGTTAA TAAGTAATAC AGATCATTAA TCAGTTGAAT TTTTCTTGTA TTAAATATTA TACAAAAAAT CAAATGCGCT TTGTAAAGTT CATTAATTAC GCGTAGGGTA AAATGGTACA CAACATTTCT TGAGACTTGA CTATCGATAC CAGTTACATA GCTATTTGGA GTGTATGGCA TCAATATCAA AATTTATTTA ATTTTTTTTC AATAAATAAA TGCACGTTGA ATCTTAACAT ACCTTTAGAC AAATCTAGTA TACCCTTTGC TCTACGAGTA ACAGGTATAA AAATTCCATT TCTCTTAACT CCATTCACTG AGCTCTTTTA TTTGCATAAA ATGCGAAGGG ACAGAACAAA GGTAGAGGGG A