Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT039556
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207659
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 239556
Nearest Genes
Gene Nr FlyBase ID Distance
CG17117 FBgn0001235 19228 bp
Sequence Length 2096
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCTGTTTCACAGTTGTGCAGCCATT
Right Primer TGCCATTAGCCGGTTGTTATTGCC
Template genomic
Sequence GCTGTTTCAC AGTTGTGCAG CCATTGCAAG ACTAGGCATG TAACATGATT TGAGAGTCAT TGGAGTTTAA GGATCTTCAG TATTTAGAGT TGTATGTTCA CTGTTTTTAT TTATAAGGTA TATAGTCGTT CAAATCGTGA TTTATTCATA TAATTTGTAG GATGTAATCG TTTTAATATT GTTTGACTGT TCCTTTAGTC TGTATACTTA TGTTATTGCA TATATTTATT TATTCAGGTT TTATTGTTAT ATTTTTAGTT TTTTGCACCG ATATTTTTTA ATTTAATACA TAAAAAACTG ATTTCTGTTA AGAAGCGCGC GAATTTTGAT TCCGATTACC GCCTACAATT CATTTATCCT AAGCCAAAAA TTATACAATT CATATAAAAT CAGAGGTCCT GTCAAAAGGA GCTGTATTTT TAACACGGAA TTTACCAGTT TACCTGCATA GTTACCTGTT TTGGCAGTTA CTTGATCTTC CATGAATCTT CCTTTTGCCT ACTAATTTTT TTGTGACTTT CAACGCTTGA GAAGGCCCAT AAAAGGCTTA GGACACTTGT TCATAAATCT ACCTGATCTA TTGCGACTCA CACCCTCTAC ACAGAAAGAA ACAAGAATAT TCCTAAAATT TTTATTACTG TAAGTTATTT GAATTTAGAA ATATGCACAA CAAAGATTAA AATCCGAGGC ATTTAAAATG TGTTTGATTG ATCTATAAAA CGTATATCCT GTTTTGTTCT GTGCAGCAAA GGTCCTGCGA GCTTTATTTA ATTTTTCTCC AGTCATTATT CAGCCTACTT TAACTGACCC GAAGAAAAAT CGATGGCAAA TTTGCTGGTT AAACAAATGT GCCGGGTCAT CCAGGACGAT GTCCTTTTGG CATTTTCGAC TGTTTTGCTC TTCTTTTGAC AGCCGCCGAC AAAAGTGTCA ATTCCATTTC GGCCAGCCGA CGGGCCTGTC AACAAGCGTG GTCTACACAC GCCTACCGCC CATCGCCCAC TGCCACCCCG CTAATCTCAA GGACACCGCC GGCATCACAA TATATTTCGT TTAACTTTAG GCTGTCTCCT TCGATGGCAT AATTTTGTAT ACAGTGGATA GAGTGAAAGG GTAAATAAAC CAATATTTAG TCGGTTTATT TTGACATTAC ACGACATCGT ACTTGTTATT AGCCAATTTT TAAAAAATAA ATAAATAATT TACTCTACTC CTTCTATCAC CCACTGTATA AAAATAATTT AATATTTATC ACGCTTGAAA ACTTTTGTCC ACAAAGTTAA TTTCCGAAGG ACTTTAGGTT CCTAACTCAC TTACCTGCTG AGGGATTTTG ATCATACTTT ACCTGCAATG AAAATAAGAA AATTGAGTTA GAAAAAGGCA GATACACAGC TCTGGTGTTG AGGAAAAGTC AGGAAGAAAA ACATTGGGAT TGGGAAATGC AAATGAGCGG AAGGCAACGG GGATTAAGAT GCACCGAGTC TTTCGTCCAT CCGAATGTGA TTGTGACCAC ATGTGTTGTG CACCCCTCCA GACAAATCCT CCAAAGTACA AACTACGAAA TCCAAAACAC AAAATTCAAA ATCGAATATA CGAAATCCTC ATCCCGCTCC CAAGTGACTC ATCCCTCTCA GGACCGGTGA TCTTTTCCTA GCACATTTGT CGGGAAATGT TTTTCTTCTG GCTGCCTTTT GATTGATTGC CCTGGAAAAC CACTTGAAAC TGTCAAGGGC GCAATTGGGG GCGGGGGTGC CGTTTTCCAG GGGAGTGAGC CCATCGAAAT GAAGTGAAAA TCACTTTTAC ACAGATGGAG GAAATCGTTT TCCTATGAAA AACTACTTAG TCCAAATGGA GGCGGGCGAG TAAGAAGATG CATCATGTTA ATAACTAAAT TAAGGAATGA GATACCATTT CTAGGATTAC AAAAGCGGTC GCTAAATGGA CTTCTAATTC GTCAAGGGGA AATATTTCGA TTGAAAATTC AAGTTATAAA TTGTACAAAG CATAGCAAAT AATACATATG AATAAACTCC GGTTAGAATT TAATCTATTA TTTGAAATAA ATTCAATAAT TTGGCAATAA CAACCGGCTA ATGGCA