Vienna Tile Information
VT ID VT055790
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207575
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 255790
Nearest Genes
Gene Nr FlyBase ID Distance
CG7952 FBgn0001150 0 bp
CG7925 FBgn0003714 12542 bp
Sequence Length 2519
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer GCTCTGATGTTGCTATATCTTCACGCTGAC
Right Primer CCCGAAACCAAGCACGAATCCA
Template genomic
Sequence GCTCTGATGT TGCTATATCT TCACGCTGAC GATGTCGAAC GCAAACTGAT TTCCTCTCGT CGGAACCCCC TGCATTTATA CCGAAAATCC GGAGGCTGCG CCGACGCCTC ATTCACATCG AAATGGCGGA CACGAGCGGC CAGCCGAAGC GGTACGAAGC AGGTAGGCGG TACAAAGGCC AAAGGGCAAA GGGGTGATTC TGGCTTTGCT TCTGACTCTG TCCCGCTCTG GCCTGTTGCC CTCTCTGTCT CACCGCTTTC GAAAGGGTTT TACAAGGGTG CGGCTGCCCT TTCCCTCATT TGGTTTTCGC AGTTTTCGCA AAAATCATAG TTCTTTGTGC TATTGTTAGT TCGCCATTTA ACGTAATTTT AAAAAGAAAG TACAAAGAGT TTTCGAACTT TACGTTTCAT CAGTTTCCGC GAAAGGATAT GGTTTTTTCT TGGTTTTAAT ATTCAATGGG AAAAAATAGG AAAATTCGTA CCACCTCTGC AGTGCTTTAC ATTTCGTTTT CATGGAATTG GTTAAAAATA TTCATAATCA ATATAGAGTT ATAAACTTCG GCTCTATTTT CATAGGCGTT CATTGCGATG TTATAAGTCC AAGTTTGAGG AAACCCCAGA TTTTTGTATA TACCAGCATT GTGCATTTGA TTTTTTATTA CAATTGTACC TAACTTACTT GCTTTGACAT CCAACTGATA AAACCCTTAC CCAAAAACCA ATCTTAAAAA TCTTAAGTTA TTAAACCTTT AGATTTAAGT AACTGCTGTA TATATTGCTT TCAAATATAA AGAATAAACC GCAATTAAAC ATCGTAGGCT ATTCTCTTCA GCACTGAAAT AAACCATACT TCTGAATCTT CTAGAACATT TCGCATATCA AAGACCCCCC GACCGTAGAC TATTATAATT ACACTCAAAT CATACTTTTC TGGCCAGAAA GAGAGGCATC TGGCAGAAGA AAAGAGATGG AATCTAGTTT GTTGATAATA GATGCACAAC ATCCAAGGGT TGTGATGGCT AAATCCGTTT GTTTTGCGCT TTTGTTTCGA AATCCTTTTG CTGACCAGCC CATCTAGAAT CTGTGTATCC ATGCGATGGC GAATTCGTTG GATTGTGCGT GACAAATTAT GGAAATTAGG ACGAGTTCTG GCGTTCTTGC AATTTTCAGC CCTTTTCGGC TGGCGTAATT CGCATCCTTT TCTTATTTCG GCAATGAAAA CTCGGCTTCC CGGAATTTTG GCAAGGACAC TCGCCAGTCT GCCCATTTGA TTCATGACGC CGCCAGCCCG AGGATCGAGA ATCGAGAGTC CAGGATCATT GCGACAAGTG GCCGTCCGTG TTGACTGCTC GTGTTTGCCC TCCTCCTTAA ACATCCTTGA TTCTACGTCC TTTATCCCTT TGGCTTCCGC TGCGGCGTGG GATGTGGGAT CCTCGACAAG TTGTTTCACT TTGTTAACTG TTTGTCCTAA CGGTCGCCTC GACAGCCAAC GGAAGTGGGT AGCGGTACAA AGTTGGCTAT CATCCATGGG AAATGTTATG CTAGATACTT ACTGCAGCTA ATTCGAGGAC ATAACGTAGT TTAGATTTGT TACGCTGAAA TGTTATCAAA TCCTATCAAC AATACCTACA TTATATACTA TCTTTCATTC ATTCTCTTTT TACAACTGCC CATTCAGGGG GATTGGGTGA ATTGCAAATA AAAAGAGGGA TCGATCGATG GTAATCAGTA AAAAACCGCG AACTTATCCG CTAATCCGTG CGCTAATCCA ACCGTAAAAA TGGTGGATTA AACTAAAACT CGGACCGTCA CGTCGCCGTC ATTGAGTCGA TCCCTTACCT GCGGTTACCG GGCCCGAACC CGAGCCCTTC CAGATCCTGG ACATACGTAT AGCCCAGCCC AATCGATCCC GAGCAGATGC CATAAAAAGT CGCGGCCGAA GTCGAAGCCA AAGAGTTGCC AAGTTCGGTG TAAAAACCAG ATTCAGCGAA AAAAAAACGT AAAAAACAGC AGGCCATAAA ACCATATATT CATATACTCG GACTGCTGTT CCTTCGCCAT AATGAGCTCC GAACCAAAGA TGCAATATTT GTGCAATCCT TTGAGTTGTG ACCTTGGGCG CGTTTTTTAC GGAATCATCT ACCTGATGGC CGAACGGGTT GCCCACCCAC GGTATGCGCT GTATTAGGCT GTTATGCTGT TGCCTAAAAA ACATCCAAAG TTTTATTGCA TAATGGACGC TTCGTGCGAA AAGGCCTCAT TCCGAGTCCG CGGGCCCTAA AACCGCTGCA GTTTTTTAAG GAGCCATAAA CTGATATTTC GGACACCGGC GGTCCTTAAA AAAAAAAGGG TTCTCTCCTC CGACCATTGT GGCTGCGATT TTTATATTGG TCCGCTGCTA GGTGACAAAG AAAATCAGCG ACTAATTGAC TGAAAGGGGT TTTGCCTTAT ATGACCCGTC CCACCCGTCC AAAAAAGGGT GAGGAGTGGT TTGGATTTGG ATTCGTGCTT GGTTTCGGG