Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT006169
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207513
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 206169
Nearest Genes
Gene Nr FlyBase ID Distance
CG6716 FBgn0003145 2885 bp
CG5325 FBgn0032407 2928 bp
Sequence Length 2169
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TTTCCATGTCCACAGCCCACAGAAG
Right Primer CACGGTCTCTGCAGTCAATTTTTCCA
Template genomic
Sequence TTTCCATGTC CACAGCCCAC AGAAGGCTCT GACCGACGAA CGCACTACGG GATGCTTAGA TAATGGACTA TTTAGAGCCA TGATTTCCAG AAATTAGGGA ATTCTGGAAG GCATATCGTA ATACACCGTG GCAAGCAACA TCTTTAGACA TCGTATATTA TACTTAGTTA GCAAATCTAA GTACTTAGAT TCTAAAGAAA TAGCACTATT TATTTAGCTA CAGGCCTACT AAAGATATTT TAAGGAAAAG CAAACATTTC AACTTTTCTA ATAATCCTTG TTTTTGGTTT AATGTAGTAT TATATACAAT TTAATTGATT TTCAATACCT TCATTTAGCT ATGTTTCTAG CTGAAATCTT AAGCCCCCTG TTGATCCTGC GCTTCTGCGC TGATCCTCAA ATATTTCCAC TCGCTCGACA GACTGGCAGG CGGCGATTGA CTTTTTCCTA ATCCGCAGTA AGTTTTAGTA AATATGAGTC GCATTCTATC CCGTGGTCCA TTCCATCCTA TCCCATCTGA GCTGAATCTC CCAGAGCGAG TCCTTTCGCA GGAGTCCTGT GACCGGAGCG ATCGTAAATC GCAATCCCCG CTAAAGCATG CAAACAAATA GCGGCAAAGT GCGAGATTAG AGGGAAAGTC GCAGCAGCTT AGATCCTGGA TCCTGGCCAG CCTGTGTCCT GGATCCCGTC GATCGCCAGT TGACTTTTTC AAATATTTTG GAAAAGTTCT CGAGTGTTGA TCGCCCGATT ATAGCGGATA ATCGCATTAC AGCCCGACGT TTTATTGATC AACAATTGTA AACGATTTGC CATGGCCCAT GGCAATCTGG GTGGGTCAGG ACGAGTCGGG CCAACTCGGA GTCCATGTCC AGGTAGTTAT CGAAAAAATG CTGCGGCTTA ACGCAGCCCA CGCCCACTCT ACGACAAAAA GTGGGCGGAA AGCTGAGGGC CTTTCCCGAT CTCCGGGCGA TTAACCCTTG CTCTTGGTAG CAGTTTAGCC GGGCTAATTG AAGGCATTAG TTGTTTGTGG GTCGCGAGCT GGCTTCCCCG GAACTCCATT GTCCTTAAAT TAGCATCTCT CATAGCATAT ATACCTTCGA TCGCAATTGG TGGAAACTTC GCGCCTCTGC CCACAAACGT TTGGTTTTGG CACTCCAACC ACATGACATT CGTCATGCAC TCAGCGAAAA TACTTAGCAA ATGTTGTTCA TGCAAAGAAA TATTCATATT CTGTATAATT ATTGCTTAAG AATATATATT TTTCAGTACC TAAATGTATA AGAATGAAGA AGCTATAAAT TAAATAATAA ATAGTTAGTT AGTTGAAAGG GATTATCTTC CTGTGTATTG GGACGTCACA GAGTCTGGCT GAATTTTCGC CGATCATGTA GGAAGTGTCC CAGGGGCAAA AAGGGGAGCC CCTGCCACAT ACACCCACTT TCGAGAAACT CATTAGCCTG GGGCACAACA AACCCGGCAA CTCGGGGCAC AAACAAACCA ATCCCGAGCC CAATCGACTG CTAAACGCTG TCGGCACACA TCTGAGAGAC GGCGACGGAG GCCAACAAAT TGATCATTAA ACAGAAGGCG CAAATGTAGG CGCAACCCAT CGTTGTCCAA CAGAAGATCG TAGCATCGGA GCATCAGGTC GAGATCAAAC ACCTGGGCCC TCGACCTGGC GAAGAAAGTG ACGAGGCTGC GACGTCAACA AGATTAATTT GTTTTCCGGC CGGGTTCCAT CTCCATCCAG AGTCACAGAG CCACATCCAC ATCCATATTT CCCAACTCAG CCGGCAACCT GTTGTCCAGT TCCCCGATTT GTAATTGCCC TGCTTTGTGG TAGTCGATCA GGTTCGATCG CGGATCGATC ATATACTCTA CTATAATGGA CAAACTCGAT GGATGGCGAA AGAACATCAT TAGTTTTCTC GGCGTAGAGT CCACAAAGTA GGTGGCGTTT TTCTCACATC CCGAGTGTTT CTATGGAATC TCGATTTGGA GATGTTGGAT CTTCTCTTCG GCGGCGTTTG TCCATTAGCC ACGGTTTGCA TCGGATATAT GCGAATTTAA ATAAAATCAT TCAATTGTTT CATTAATCAC TGGCTACGGT CGGCGTTTTC TATTAAAAAA AATGCATTGC CAATGGAAAA ATTGACTGCA GAGACCGTG