Vienna Tile Information
VT ID VT027805
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207461
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 227805
Nearest Genes
Gene Nr FlyBase ID Distance
CG5751 FBgn0035934 0 bp
CG5747 FBgn0035935 6637 bp
Sequence Length 2430
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CTGGGCCTCCATGAGGTCAGGT
Right Primer GACCATTCCACTTGAGTGAGGACTACTGTTT
Template genomic
Sequence CTGGGCCTCC ATGAGGTCAG GTGGCGATAG GGCGCCGCAC TGACCGCTGT AGACTCCGTT GTAGAGCTTG GGCATCCTGG TGCTCTTGGA ACTCTGGTTG CGTTCCGTGG CCGTGGCCGG AGCTGTAATC ATAAAGGGCC GCTGGTCGCG ACTGTACGCG CTGGTTAGTG CCTCGTTTGT ATTTTGCAAC TTATCAAACA TCATCGGGCT GGGCAGCAAT CAGTGGACTA ATTAGATATT GATTGGGTTA AACGGTTTGC AAACGCGTAA ACCGACAGCA AAGCAATTTA GATAAACCGT GTGTCACATG ATATCGCCAG ATATAGGAGA TACGAGCGAT ACGACGATTC ACACTAGATA CAACTGTGTC GGACTAGAAC TGAAGCGTAA CTGCAACTAG GGCTAATTTA GCAGTAACCC TTGGCCAATT TACACGCACT GAGCCGTATA TATATACTGT ATGTATAAAA GTACAGCTGG CTAGCAAGTC AATGGCCATT TGTCATTCTA CACATTTATA GCCACTGCCG CCCGAGGGAA TCGAAGCCGG GACTCCCTTT CGCGGGCCCA TTAACTGGAA CTGTCTAATT AATGGTTTGT TTATTTTCGC CACTCGACTG GAGAAATTTG CATAATGCCA AGCCTTTGTA AATCCAGACT TACTTAACTT CCGCCAGCCC CATTTTCGAA CTGCTTTCGA CGAGCAAAGG ATTCAAACTG CAAGGCTTCT CATAGTGCGC AGATATTTCT AGGCGGGTAT TGAACATTTA ATTACATTGA AGAGATACTT ATCAGATGAT TTGGACGATT TCCGTCTAAT GAAATTAGAG GTACTAAGCC TTAGGTGAGA AAAAAAGCTC TGATTATTTC TACACCCAAT TGGATGAGTT GACAAAACTA GAGGCTTTTT GATTAGTCTA AGTGGTGATG GTGGGCAAAT ATCAGAGCAA ACATTGACGG GCCATCGGGT AAATAAATCC CTTAATTAAA GGGAAATTTA AGGGGTTACT TTGGGTCATG AGTACACTAT CTACATGGTC TTGCAAAAAT GGTGGATATA TTATTCAGAT TATTGCCTTA CCTTTGCTAT ATTCCAACTA TTCAAACCCT AGCTCGTTTT TCCACTCAGC GCGTTTGGTA TTTTCTTGGA GAGCAGCTGA CAGGATGCAC TTACATTTTC AATCGACTTT GAATTTAAAA AACTTGAATT TGATTTTGAT TTCGGCCAAG ACTAGAACGG AGCACACGGG GCAGGCACAA CTGCGACAGC AGCAGGAATT TTCCGAATAT TTTCGCACTG AGTTTAGCAG CATTTAAGGC TGCTTGCCAT ATGTTTCACT CTCGATCCTC TACTGCGACG TGGAGGAAGC ACTATAAGAA CGCGAGCAAG GACTTTGGCC TCTGCCTGCA AAGGCAAAGG GATGGTGCTT AAGGATATAG CTAAATTGTG CTCAAACTTT CACAGCTCTG ATGGACACTG ATGGATTTAA TTATGAAACT TAATTAGCAC CTTTTGATGT ACAATTTGTT CAAAGGGGTC GAATATTCCT GTGAGTTTCC TGCTGAGTGA TTTGCGAACC GACAGCCTCG ATAGCTGGAC ACCAACTGAA CGTGGCAGCC TTTGGGCCCT ATAGGTTTCC CAGCCAGAAC GGTTCAGACC AGTTCGGGGC GGTCCTGATA AGCAATGTCA GCCTTTCGTC ACTCTCGTCT CGTTTTGCCG CGACTGCCGC CATTAGCACA TTACCACTCC GGTATAATCA AACCGATATA TTGTAGATAC CATATGCACA CATGAACATC CACAAACAAG CGAATCGCCG CTTTTGTCAC CCACATGGTG AAATACCAGA GAACCCCTGG GATAGTTCTG GATGCTTTAA AGGCTTCTAG CTCAAGAAAT AACTGGAGAT GGGATGTTTC TATGCCAAAT CGTGTACAAG GTAGCATAGG GATGTATTAG TGTATAATCC ATGTTTTAAA ATGGCCAAAG AACAGCTACC ATTTAAACAT TCCTACTAAG AATATTCATT TAATTTTAAT ATTAACAATA ATGCTTTTAT AACTGCAACA AAGATGCATA TCTACTTCAT AGGACATTTT AAATATTGCT TAGCCTTAAA TGTTTATATG TATGCAGTCC TTTGAACTCC TTATATAAAC CGACGTCATA ACCATTCAGT GGGGTTGAGT CCCAGTCCCA GTCATTATCG CATTCACCCC ACTTCGGCAC TGGAGATGGC TATTAGCCAA TGAAATTAAT TACTTTTTAA GTGACGGAGT AGCAGGGCAA AGAAACAACA AGCTAATTTA TTGAAAAACT TTCAAAACGC CAGGTAAAAT TCAATTTAGC GAACAATAAA AAACAACAAC AATAAAACAA ACAGGAAAGA AAGAAATAAA AACAGTAGTC CTCACTCAAG TGGAATGGTC