Vienna Tile Information
VT ID VT015250
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207450
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 215250
Nearest Genes
Gene Nr FlyBase ID Distance
CG13194 FBgn0033649 0 bp
CG13195 FBgn0033648 7313 bp
Sequence Length 2540
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TCTTACCTTAACCGGCAAACGAGGTG
Right Primer GGCAGCGATCTACAACCGACGAAAG
Template genomic
Sequence TCTTACCTTA ACCGGCAAAC GAGGTGACCT GCAAATTAAT AAAATTGTTT TGGTTTAATC AGCTTGAGTA TTTTTCGCAC GCTGTAGTTC TTAGCAATTA GCCTGATTTT CGATTTGCCT AACCACTTGA GACTGAAGCC TGGAATTTCG CATCACAGTT ATTGATTTAA TTAATTTATC ATTGTCATTA TCAATCAAAA ATATCGTTTT GTGTTGTTTT TATTAGTTTG TCATTGCAAA CAATTTGCAA ACTCATTAAT CTTCATAAAC ATTTTCACAC ATGTACCTAT TTAAGTCGGT ATAATGTGCA CTATATTAGG GCTTAAAATA GGGCTTAAAA AATATTAAAA TATACATTTC TATACTGCTG AAATTTTAAA AGAACCAACA AATAGTTTTC ACACTTTGCT TATTTTAATT TTCTTAGATG ATGCAATTTA AATTTATTAT AGAAAAAGTG AAAAACTTTC CAAGAAATTG AAATTCACCC CTAAATCATG TTGCATACCA TGTTCGATAT CGAACGGAAA TGTTAATGAA CTCATATAAC AGCTGGCTTA CGCATGCACT GCTTGCCGTC GTGTCAAGTG CACTGCTTGC TAAATAACAG AGCTATGTAC TTGGCAAGGT CCGCTTGATT AGCAGAGCAT GCAACATGTT TCAGCCGCAA CAAGTTCGTG CTGTTAAATA TAGCTGGAAA TAAAATAAAG ATGTGATAAA AACCATGTTA ACTGAATTTC AACGATTTTA TCGGATGTAA AAGATTGGCT AAGTCGCGTT ATCAATTTCA TCACCATTAT GGGGCGCCAT AAACAAATAG ACCGATCCTA TTCGATTATA CTGCCATCAT ATTTCATAAC TGTTCTCGCA TATCATCGGA ATTCTAGATC ATTCATATTT CGCTTTTAAT TATGCGTCAT TTGTTGCGTA GCATAAAAGT CGTAAGCAAA ATTGCTGACA CCGTCGAATA TTCGTGATCA CATTGGTATT TTTGATAACA GAGAGCAATG CTACTGTATT TCTTTCAAAG CATTTTCACT TCATTCATGG CCAGATGATA TTTTCTGAAG AGTCTAGTGC TCTAATTGAA CCTATCACAA AACTTGTGCA GTTATCTAGG TAACGAGTTA ATTGGAAATT GAAACATGAG CAAAGTCCAC ATGGGCTGTT GTTCTCGTTT TCGGGGGAAG TTCCCCTTTG ATAATATCGT GGGTCTCATG GGTTATTCTC TGCCCGATCA CTGGGATGCT GACGTATTTA TTTACCAAAA CATTTATGAA AAGTAATACA TTTGCTTACT GTTACTATTT TACTATTTTG ATATACACCT CACAATGACC AGGCTCATAG CAACGAAAGA GCAACAAAAC AATTGAGATT ATTTCTTTTG GATCATTATC ATTGGACTGA CTTATTGCGA TTCTTGATAA ACCTTTTATT TACATCTCTT TATTCCTGCT TTCTGTTACC CAAATAAGTA TTGCTTAATT TAATCGTTGT ACGACGTGTG CTTTGTTTTT GGGTCGCTAG CAACACACAA TTTTTGATTT ACAGCATGAT CAATAAAACT GCCTGATACA ACTTGCTGGC TAATCGATCA ATATCAAAAT GCAGGGGCAA CTTTGCTAAT GGCTCGCCAA CTGGACCTTG CCCAATATCG TCTAGCATTT TTTTCCGGGC CATTCGGCGG TATTAGACAT ATGGAATTCG GAATTGGGTG GGTGACTAGT TTCAGCCTTT TTTTTTTTAA TAAAGTGGAG CAGGTGGACG CCACCCAGAG ATCATTATCT GGCCGGCAGA CCCAGTTTTC CTAAATGGAG CAAGCATTTC AAGGAATGAC AAACGCTGGT CGGTCTCATT ATTTATGATC ACTGAAGTTT GGTGGAATTT GCTTGTGATC TAAATAAATT ATAAACTATA AGAAACCGCA TTTTACAATT ATGCTATTAA ACCAAAAATT TCCTTGAAAA CTGTGTTTTT TTAATTTAAA AGCTTTACTG TGAGTAGATA GGGTAAATGG TCGATATTGA ATTGCACTAT AATTATTCTT TGCAGAAGCT AAACAACGCT TAAGCAAACA CTAAACATGG AAGATATTCA ATAAAAGTGC TAAATTGTAT CTCGGTAATT TGTGAAATAT GTTCTTTGAG CTCCCAAAGA ACCTAGAAAC CTTTGAGAAC GAACTGGCCC ACTTGGAAAA TTTGGAGTCG AGCCGCATGC GATCTGCAAG GAAGTGAGAG AAGCGGGCGA GGAATTCCGG ACCAGCCTTT CCGCCAGGCC ATCTATCACC CACATGGACA TGTCTGCGCC TCAAAGAATT TATAACGACA AACTGTAAAT GCGAGGGTGG CCGGCGGGGG CGGTTCGAAG CGGGAGCGAG TGCGAATGGA AACGAGCGCG GTACGAACAC GGTTGGCCGC ATTCGGATTG TCGGCGGCGG TTCGATTCGA GACGACGACA AACGCTATAG CTCGATGTTC GACGACGCTC AGATTCAGAT TCAGTTTCTT TTCACCTTTC GTCGGTTGTA GATCGCTGCC