Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT026772
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207410
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 226772
Nearest Genes
Gene Nr FlyBase ID Distance
CG10078 FBgn0041194 43176 bp
CG10037 FBgn0086680 79234 bp
Sequence Length 2291
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer AGGATGAGGATGAGTTGTGGGTGGG
Right Primer CTGCATGCCACAGTGTGCTTCAAAA
Template genomic
Sequence AGGATGAGGA TGAGTTGTGG GTGGGGACTG TGGGAGGACT GTGCCCGCGA GCCTCAATTT TGAGGCAGCC CCTCGTCACC GCCCCATCTT CTCCATCAAG AACTAACGCA ATCATCGACT GCCAGAGTCT GAAAGCAACC ACCAACCAAA CGACAAGCGA CAAATGCCTC ATCAACTCGC TCCTCTTGCC GCCAGAAAAC AACGACGCCA TTGCTTTTAG CCAGAGCTAT GTGGCTATAT GGCTATGGCA ACAGACCCAG ACCAGACCAG ACCCATCCTT ATGCCACCAC GACTCATCCA CATCGTCGTC CACATCCACA TCCACGTCAC AAAACCCAAA AGTGTCAATC CAATTACCTG TTCGAGCGCC GGAATCTTTT GCGACATGTT TCATAACTGT GGCAGCGTAG AAAGACTTTC ATTTTCCGGG GCGAACAGCG ATGAGGCCAG AGATCCAGGG ATGCAGTGGC TTCCGAACTC CAAATAAGAT AACTTAGTTT GAAAAGTGTG AAACGCTTAA GGGTATTACT CTCTATATTC AAAACCAAAT GAATGTATCG TAGGAAAATA ATATACAATA ATAACTGATA CCCAAATAGA AACCCAATAG AAACCTTAAT ATTCCTGCAT CCCTGAGCAT CTAAGCCCAT TCCATTTTGC CATTTCCATT GCGAGAGGAC CGAGCATGCT TCGTTGGCCA AGCGAAGCAG CGGTTGGGGA ATACTGGGGG ATACTGTTGC CAATGGCGTT TATCAATTTG CCAGCTCCAG ACTTCCGCTG AGCAAGGGAG ATGGACAGAG GCCGTCGACG ACGGAGGACG GCCCACCCAC AAAGAATCCC GCCGAGTAAA AACACAAACC ATTTCCATTC AGACTCGCCG TGGTCCACTC ATTAACACGT GTTTACGTAG CCAGTCCTTT CGATCTCGAC GCGACGCCAA TAACAACCGA TAACTGCCCG ATCATGATCT GCTCAGTACA TATATACATA AGTAGAATCC CTAGCCCAGG TTCATTCACC AACGATTCCG TTTCGATTCG AATATTATTA TTTTCATTGT TAATATTTGT TACACGCCTT TTGTTCAACT GGCATGCATC CCTGCCATGC CATCCAATTC CATCTGAAAA CTGCACTCGA GAGCTCGAGA CCCGTTGATT GCCGATGATG AGGATGATGA TGTTGGTGAT GACTCAATGT GCGGCTCCCG ATCTCGAGGC ACCGAGTGCT TATTTAGTGA CTGGACGAGA TCGGAGGCTC AGAACTGGAA ACTGGAAACT CAAAACTCTA AACTCGAGAC ATGAGACACT TCTGGCTGCC GTTTTGGTTG TTTGGGCTGT TTGCTCAGCC ACTACAAAAC CGAAACCTGG AGCCAAAACT CCCGCGATTG GGACCGCAAA ATGGGCCCTG AAGTGGCGCA GACAATTCCC GGCTCCATCT CCATCTCGCA CTCAAGTGCA GCAAGATGAC CAAGTTAATT TCGAGACGGG AGGCCCAAAC CGCGGAGTGG TTATCAATGG GGGTCTACAG CTTGGCGGCG TCTGCGGCGA TGAGCCCAAC TGGTAGCCCT CTAATTGATA TAGCTAAATG GCCGTCTATG TTGCAGGCTG CAGGTTGCAA GTTGCACGTA GCTTGTTGCT GGATTGCAGA AGGAGGATGC AGGCTGGAGG ATGAGGCCTA GAGACATGTT TCATGTCGCC AGCGCGTACG TGGCAATGCG TAGAATTCCA TATAAAATAA TTAATGAATG TCACAGCAAA ATGTTTCGAG CGAGTTCTCC TCCAGCTCGA GCTACAGTTC CTGCTTTTGG ACTCGTCCTC GACTGATGGC GTTCTTGCTG CTGATGATGA TGATGAGGCC TCCAACTCCT GCTTTCCCCT TCTGGGGTAC GTGGCTCCTC CTCCAGCTAC TCCTGCTCCT CCTTCCATTC TCGTATCGTT TTGCCAGCAT TGCGCGCATA TTTGGCGTCA ATATTAAGTG AAACTGATGG ATGCCTGAAG GCCCTACAGG CCTCCTAAGT GCACTGGGAG AAAAAAAATG TTTATCTAGG GACAAGCTCC CAATAATCTT TCACAGTAGG TGCCGTACTA CCTAACAAAA CTTTCTTAGA GACTTTAAAA TGCATAAGGT GCATGACTTT CAAACCCCGA CTCCACTTAA CTTCACCTTA GTTAAGTATC CTTTGTTCGC AGTGTACCGC GTCTGGCAGT CGTCCAGGTA GGGCCCATCT ACGTCTGCTG GCCCCTAGTA AAATGCGAAA AAATAATTTT GAAGCACACT GTGGCATGCA G