Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000248
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207332
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200248
Nearest Genes
Gene Nr FlyBase ID Distance
CG3018 FBgn0010602 0 bp
CG11840 FBgn0031260 1681 bp
Sequence Length 413
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGAACGCTTGTGCTCGCTAAAGGTA
Right Primer TCCGCACAGGAGGCTTATATGTTTAAGAA
Template genomic
Sequence TGAACGCTTG TGCTCGCTAA AGGTATAAGT TTTTCTACAC AAAGGGTCTC ACTATGCGGT TATCGATATT TAGTGTGGCC GTGGATAAAC AGTGGTATTA AAATACTGAC TTTTTCAAAG CACTTTTGTA TTATGTTTTA AATTTAAAAA TTCTTTGGAT TTTGGTAAGC TCAACTTAAA ATGTATTAGG TTTTTCTCTT AAGCCGTTAC ATTCCTAAAA ACCCTCTACT CAATACAAAA CTAGTTTAAT TAAACGTTAG AATTAAAATT TATTCGCATT ACTGTTTACA CAAATTACTG CATTAGTTTT AAGAAATGCA ATGTAGAATT CGTAGTCAAA ATTGCACTGT TTACAAAAAT TGGAATATAT TTGTATCTAA ACTGTTCTTA AACATATAAG CCTCCTGTGC GGA