Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000009
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207331
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200009
Nearest Genes
Gene Nr FlyBase ID Distance
CG2671 FBgn0002121 0 bp
CG2657 FBgn0031209 3194 bp
Sequence Length 632
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGCGCGTCATTTTAACACACACAAA
Right Primer CGGCAATCCTTCCTCACATACATTCC
Template genomic
Sequence TGCGCGTCAT TTTAACACAC ACAAAGTCGC GATCGGTGGG TCTAGTGTGC CCGTGTATCT CTATCGAAAA AATCATATAT TTTTTAGAAG GTATATTTAC CATGACTGAC TGGAATGGGT GGAGAACATC GCTTTGGGAG TGAAACTCCG CTATAAATTG CCATTTGTTT TTATAGCAAC CTTTTTGATA TGGTCGCCAA CTTTTATATA ATTATAATAA TTTTTGTATA TATAATCATA ATAATATCAT ATAATAATCA CCGCTGTCGC ACGAAAAATT TAGAAAATGT GCCAACGAGC GGAATTTTTC GGAACGATCG ATGTTTTACC ATAACCTGCT ATATAAATTG TGAACCACTT TCTTAACACA AAACTAGATG TGCTTCATTT ATAACGCAAT GTTGTGATTT GTGGGCAGTG TGACCATGTC CAATCCGCTT TCAAGTAAAA CCATATATTG CCACAAACTT TCCCATACAA AATACCAAAC AACTGTAAAA TTTGTTGTTG CATCAAACTT TTTATTTCAA TACATATAAT TTCATGTGCA CTAAAGTGAT TATTTTGTAT TTGCATTTAA AAATTTCTGT GATTAATTGT CAATACGGAA TGTATGTGAG GAAGGATTGC CG