Vienna Tile Information
VT ID VT055855
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207324
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 255855
Nearest Genes
Gene Nr FlyBase ID Distance
CG13758 FBgn0040378 0 bp
Sequence Length 2533
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CTATGTTGTTGCGGCGACTTTGTGT
Right Primer CTGGAAAAGCGAAACGAACGCCAC
Template genomic
Sequence CTATGTTGTT GCGGCGACTT TGTGTCGGTT TACATATTTT TTGCGGCTTT TGTTTTCGCT TCGAATTGGT TGCACATCAC AAAAAGCAAT GGCAGTTGCC GTTCCCTTTG TACTTGCCAC CTGTTGCCGT TGATTTTTGT ACAAATATTT TTGCCACATG CTCGCAGTGG TTGATGCATA CCTTCTAGTT GCATCCTTAA TCATTACTAT TATGGCTCTA CCAGTTACTT TTGTGCCAAT GGAAACACCT TTTCATCCTG CCTCCATTTG TGGCAGAAGT GCGGGGACGG GCTTTCTTCT CCACGTGCTC CATGTTGCAC ATTTGAATTT TTAATTTATA TGGCACTTGC AGGCGTTGCC GCTGTTGTTT TAAATTCAAC ATTTGTTGCA TCTTTTGTGC TCATTAGCAT TGTGTTCCCC TTGCTATTTT TCATACTCTT CCTTATGATC CACATGCATG TGTGTAGCAA ATAGCAATAG CCTATAGCTT ATAGCTTATA GCTTATAGCT TATAGCTATA GCTCATTTAA TATAGTAAAT AGCAGTGGCT GATACTCGAG ACAAGTTGCA GTCAGTTCCG ATTGCGCCCC CAGTCGCCGG TTGCCCGTCA ACGCCGCTTG ATCGTCGGAC GTGCCAAGTT CATTCCGTAA ATCCCATTCC GTAAGATTAC CGTTTGGCGG GCAAGCGGTA AAGATTAGAC GCCTAATCGG AATCGCTTAG ATGCCGAAGT TCAGGGACAG TTCACAAGCG CCTGCTATTA TTGTTTCGCC CGGCAGCCGA AACATTTAAT TGCATTCAAC AAGAATGCTG CCGCAGAAAA CAAACTTCAT CTGGTCGGGG CAAACACAAA CATCTGCTGG ACCTTCGAGT GCTGTTGCCT GATTTATGAA TTCTGCACAT TTTTTGTTTG GCCCAAACAA ACACCAGTGT TCCATATGCG TGTGTGTGTG TGTGTGTGTG TGTGGCATTT GATTTATGAA CGTGTGCAGC ACAAGCGTTG CATTTGACCG CATTACATGC AAAATGGGTC AGTCAGTCAG TCAGTCAGTC AGTCAGTCAG TCAGTCAACT AGTCAGTCAG TCAGTCACAT AGCCAGTAGT CATTCATCCC ACTAGTCAGT GACTATAATT AAACATAGGC CGACCGATGC TGGCACAGTT TTGCCCACAA TTTTTCTCCA GCTTTTTGTG CATCTTTTCG TTTGTCCAGT GCAAATTGAA AAGCCAGTGT TCGGGCAGCC ATTGCAGGAG TCGCAGCCAG ATTACCCTGT AAATAGCTAC GGATGCAATT CACATGAACG CGACTAGCCG ACTAGTTTAG CCCACACTCG CAACAAACGA TTGAGAAGCG AATCAAAACG TGACTAGGCC AATGTTGACG TCGTTGCTGC TGCTGCTGCT GTGCCGCTAA TGTCGCTGAT GCTGCTGCGT GCCTGCAACA GTTGCTGCCG CGGCGCGTTG ACGTGGGCGC ATCGTTTCGC ATCGCTTTTT GCTTGTGACA GCGTTTCGAG GCGCACATAT GCCTATATAT AGCCCGTCAT ATGGGGCGCC TTGCCCGAGC TGGTCACGTG CTACGCCGGA GGCATCAGTT GCATGCAGCG TTTAGCTGGT TGCAGCTGCA GTCACAGTCG TGGTACAGCA GCAGCCAAGG ATGCAACACT GAACACCAGA CAGGTGCCAC TATTTCGAGC GCAACTGTAT GTTGCCTACT TCGTAGCGCG TTGCATTCGT AGTGGCCTGC ACTTTGGCGC CTAATCTAAA TCCATTTTAC TGAAGGCGTC GAGGTCATAA ATCCTCCTGC AGCAGGGCAT CCATCATTCA TCGTTGTCAC ACTCGTTTTG CCACGTCAAT CATCATTACG GAGCTGAAAT TGTCACGCGA ATTCGAAATG CACAGACAAC CAGGCCAAAA TGAATGCAAT GAATGAATAC GTCGCAATTG TGGCTATAGT TTCATAGTTT AACAGACATC AGGAAGTAAT TAATTTGCTC TCGGCAATTA AAATTTCATA TAAATAGGTT ACGCCCAGAT TTGACAATGT TTTCGCCTCA GTTTTTCAAT TTGATAGTTT GTTTTTGGTA CTTGGGAATG CGTGTTGTAA GAACCGGAAG TGTCGCTTTC TCCGGCATCT TGTCGTTATT ATTTGGTGTA TTACTTTTGG GTGTGTTCAT TGCCGGCAGC AGAGATTTAT GCTCACTCTT TTTTCACGGC CAGGCAGCAA AGGCGGCAAA AGTGGGAAAG CGGCAAAAGC GGCAAAAGCG ACAGAGGCAG CAGTGACAGT AAACAGTAAA CAAACAGGCA AACAAACAAC AGTGAAACTT GCAGTGCAAA AAGAGAGGAA AGAGCGAAAG ATTTCCCGAT TTTCCCTGCA GTTGCACACA CACTGAGTAA ATGACCGAGA GCCGAGCAAC GTTCGTGCAT TGGCTTTTCC GCTCGGCTTT TTCCGCTTTT CCGTTAAGGA TAAGTTGCTC GGCTGCTAGC GAGATTCTGT CATAACGGCT TCGGCACTCG TGGCGTTCGT TTCGCTTTTC CAG