Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT059438
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207221
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 259438
Nearest Genes
Gene Nr FlyBase ID Distance
CG1343 FBgn0020378 7090 bp
Sequence Length 2108
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GGACCTTTTTGACTTATTCACCTTACACATCC
Right Primer CTGGCGGGCCTAACAACAGCAAC
Template genomic
Sequence GGACCTTTTT GACTTATTCA CCTTACACAT CCAGCTGAGT ATCACTTAGT CTAATTCCCC TACGACTATG CATTCTGCAT AACAAAGATT TTTGCTAATT TCTCAACAAA AACGGGGGAA AAAAAGGCAG GAGAAAAGAA CGAGGACAAT GAAAGGAGAC CAAAGCGGAG ATAATTCCGA CACACACGGA ATTATGGTGA AAGAAAGGCG CAGAGCGCTC AGATTTGTCA GGAGATTTTC GGCTCAGGGG CAACTTAACA AGGCACAACA ATGTGTGGCC AACGACGACG ATGATGATGG TGATGATGAT GACGATGATG TATGCCACAT ATATCCTATA TATGTACGAG TATCTGGTAT GCAGTTTGTT TTCGTTACGG CTATTTAGTG CTTTGGCCTG CTCAAGCGCC TCGGTTTTTG GTTTATTTGC TTAGGCGGCT TAGGACTGAA ATGCCATAGA GGATTTATCC TACCCATTCC TCATAACGAA AAATAAAAGA AGACAAAAAT CCTCTGTGTT TGCTGTGCAT TTCACAACTT TTTATGTGGT CATATTTCTT GCAAGTGCTG AAGTGTGCCT GACTGACATC CCAAGTTCGG ATGTTTGGGA TATTTTCTTG TCTTGTCTTG TTTTTTTTTG GTTGGGATAT GTTGGGGGGC CCTTCGAATG ACAGGAAACG AGCGCCGAGC CGTAAAACGC TTCAACTCCT TGGCATGTTT AATTGCCGTT AGTTTTTACA CTCGCCAAGC GAATATGTCA TCGAATGTCA AAGGCAGCCC ACTAAAACTC AGCTCATTTT TCCGCTTTCG CCTGATTTAT GTTGTAGGTG GTGATTTACG AGGAGGGTAA GTGTTTGGGT TAGCAACTCA GACTCAGACT TTCAATTGAA TTCAACCAGA TCCTTTAGGA TTTATTCTCG CTTGTCCGTA ACTGTCCGTT ATGCAGAGTT TGTGTCCTTA AGTCAATTAT CAGCTGACAT TACGATAATA TTTCAACACC TAAATAACTT CATTTAATCC CTGAAGAATG CTGTTAAATT GGGTATATCA TATGAAAGTC AAAAGTGTTT GCGCCCCCTG ATCTTTCCTT TGATAGCTCC CACTCTTTGG TGTCTTTCTG TCAGCACTTC CCAAATGGAA AATCTCAGCC GCACAGAGGC CCAGCTGTAA ATATTGTGTT AAACATTAAA TGAAGTCGTT AAAATCGTTT AATGATGCAC TCGTTAGTCA GTCGCGTTGA CAAGTGAGGT GGCCTTTTTC ACTAGGGGGA ACTCGGATGA GACGACTCCT CCCACTTTTT GGCTGCTTGG CAATCTGGCG CATCAAAATC ACGGGCCATG ACATCAGTCG GCTGTTGTCA AAAGGAATTG AAAGGATGTT TGATGGCATG CTAAATTGAC AAATGCATGC AAAACACTTT TCGGCTGCCG CATTTGCGCA TACCGTCTCA TTATTCATAG CTAGTAAAAG TCGCATGTTG CCGCCGTGCG GAGATGTTGC TGCCACTTCT GTTGCTGCTG TTGGTGTTGC GTGTAAGTTG CCATGCAATT GGCAAATGCT TCATTCCGAT TTTATACCAC TGTTCTCCAC TGCGGCAATT AGCAATCAAG GGGTGTGAGG GAAAAGCCTT TCCAAGTTCT TTTCTTTTCT TTGTATTTTT CAATATTTAC CTTGCCCGTA TTGTGTGCAC CTATGCAAGT TACAACAAGT GTTGCTCTTG CTGTTGCTGC AGCTGCTCAA AGTCAAACTG TTTTGGGGGT CTTCTAGTCA TAAGGTCAAA CTGCGCGCAT TATCAACGCT GAAGCCGCAA GAAAATCTGC AATAATTTCG ACACTCGAAA AATTACCAAA TGATTTTGTT AAGTTGCAAG TGATTTTTAA TTATAATGCT ATTCAAATTT GTATGCAAGC CACCGATAAA CTTATTTAAA CTATTTGAAA TTTATGAAAT AACTTGATGA TTCTGAAACA TATTCGAGGC ACATATTTTT GTCTGAGTGT AGCGCAGCAA CATTATGCTT AAGCGCTGCA AGCGCTTCGT GCTTAAAAGC GCGCGACACA CACACACATA TTCCGGGGAA ACAATGTTGC TGTTGTTAGG CCCGCCAG