Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT014345
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207198
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 214345
Nearest Genes
Gene Nr FlyBase ID Distance
CG1429 FBgn0011656 8801 bp
Sequence Length 2105
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TATCCTCGCTCTTCGGCTCACAACA
Right Primer TGTTTGTCCAACTTTTCGCTTGACAC
Template genomic
Sequence TATCCTCGCT CTTCGGCTCA CAACAATGCA CACAAGCTGA AGCCATTAGG CCCCAATAAC ACCCAAAAGT GCGCGCCATA AAGTAGGCAA CACTTTCGCG ACTGCTCTTT TAAAACGCCG CTAAAAGCGC AAAAAATAGA AAGAAAAAAC CATTTATAGG AGCTGTAGAA AAACTTTCTC CGCTGTTTGT TCTTATTTTA GATGCTAAAT ATAGACGGAA AGTTTAAAGT TGAACCACTT CCCCGTTCCC ACAACTGACG TCAGTCGTTC GGCTACAAAA AGTGCAATAT TTGAATATTC AATTAATTTA TGCATTACCC AGACACACAG CCATACACGC AAACACACAA ACGTAGTCGC TGGTTGAGTG GGTGGTTCGA AAATTCCATT GCATAGCCGA GGCGCGTTGA GTGCAAAACA CAAAACAGAG ATTTCAGCTC GAGCGCCTGT ATGTATGCAC TTTTTGAGTG AAAGTGTGGG TGTTCTTGGT CTAGTTCAGT GTTTCGTGGT CCTCAGTCTT AGTCGGTGTG TGCGTGAGTA TCTGTGTGAG CTGGCCACGC ACCGCGACCA GCAAAAGAGA ACACGCCCCC AGTTGGCAGC CAGTGAGCGA ATCGACCCTC GACCAACCCC TTGGTTCAAG TTCAATGCAA TCTTCACCCA CTGTCGCTGG CGACCTTGAA GATTTAACCA CGCGAAGCGG AGGAAGAGAA AGCGTAGGGA ACATGCTAGC AAAAATAATG AACACGGTAA ACCCCGGCAA TTAAAGCCAG CACGTCACAA ATTGTTTAAT TTGTAGATAA TATGCAGGGG ATAACATTTA AAGCAACCTT TGAAACAAAC AATTGATTGC TTTCGGGTTT CTTTTCCGCC AAAGTGGAAT AGCCAATTAT GCCAGGGAAA TTGGCGGGAA ACCGAGGAAA ACTAAACTAA TTCGGTGATA CAACAAATAA CGTTTGCCTA TTTCTTTTTT TCTCAACCCT CGTGGCTTGC TGTTTAATTA GTTTATGAAC TTCCACAGCA AACAAGTTGT GCAATGCCAG GAAAATCTGA GGAAAATTAG ATAAGAACAG ATTTGAGGCG TTGTTTGTTT AAAATATGGA ATCCAACAGT CTGTACTTTG TAAAAGAATT CTCATTTCTA CTCGCTTAAA AACATAGTAA ATAAGGTAAA ACAAATAATA GAATGATCTC TAAATACATA ACAATCTTGA GGATTGAATA ACGCGTGTTT TCATTACACC ACCTGGCAAA TAGTTTTTTT TTCATCACAC GCGTCGTATG CGTAATATTA AGAGTCAATA ACAAAGGGTG TAAACAATGG ATGAACAACC GAACAACAAC TCATTTAATA AACATAGCTA CACACACTTC CAAATGTCGG AAAGAGATGG CGACTTTAGT TGAAGTCACG TGTAAATTCC AAATGCTGTA AATTAGCATT TATTGCTAGT GGGACAACTA GACCGAGCTG AGAAAGTGAT ACGGGCCACA GGAATATCTC GATAAAATCA TCTATACTGC TGGAACTTGC TCCACTGTAA CGCAAGCAGA GCAAGCGACA AAAGTGATAA ACAAACATGA CAAAAAGTCA ACAATTCCCG GTTTCAACCG CACACAATCC AATTAGAATA AGCTCGAAGA GCAATCAGAA GAGCGAGGGA GAAAACGGCG AGATCCCCAG AGAGAGAGAG AGAGCTCGCG AGTTTTGCAA TAATAATCAC AATCACACTG AGAAATATCA CATAGCCGTT TATATGTATA TATATTATAT AGATAAAATA ACTAATCTCG TGTGGAAGAA TTCCAGATCG ATGACCACTG GTGACATTGT TCTCAGTGCA TCCGAGCTGG CTGCATAATG ACATCACACC AGCGATAAGA ACGAGATAGC CTCTGAGAGC GAGAGGCGCG AAGGCGGTAG GTATATGACA TCAGCGTGTG CACGATTTGT TAACAGTAAA ACGCACGATC ACTGAGTGTG GGGAAGGGGG TGTGTCGGAA AAGAGGGGGA CCATCGTATT TCGAGTACCA ACGATCACTG ATCGAGCAAG CGCAACTTTC AGCAAATTTT CAGTTTCACG TGTCAAGCGA AAAGTTGGAC AAACA