Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000130
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207185
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200130
Nearest Genes
Gene Nr FlyBase ID Distance
CG3625 FBgn0031245 4752 bp
Sequence Length 2154
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer AGTCCTGCGAGTCCTTGGCTTCGTT
Right Primer GGCGATGCATAACTGGTTTTTGATTTG
Template genomic
Sequence AGTCCTGCGA GTCCTTGGCT TCGTTTTGGG TACGACCTGT ACGAGATGAA CAGCTCCAGG ATGATGAAAA CCACTATGTT GGTGTGCAGG ACGTGGTTGA GCCAGCTGAA AGAGTCGAGC GAAGATATTA TCAGAGTGTC ATGAAAAAAC AATGGGTGAA ATCAAGACTT TTCAGACCAC TTTTTTAATT TTATCCCTAA ATATATTATG ACGTACACAT CTTTCAAGCT TTGTCGTAGC AAGCTATCTG AATAAATTAA TTACTTTGAA AGTAAAACCA GAGCCCCAAA ACGAGATTAT AGGGTCTTAA GGTTTAGTGT CTAAGTAGCA TTTTATGAAG ATGGTTTATT ACTGAAATGA AAGGAAAAAC GTTGATCTAA TTCCTTCAAA TGTATGAGTA CTTGTTAGGA TATATATATA ATTGAAAGAT ATAGTTCCAA TTAAATCGAA CTTAAAAAGC CTGGATATAA AGAAACACAA TTAACACAAT ACCGTAAATA GGCATGTCAG TGGTATAGAA AATGGATATG GCTTGAATTA GACATGCTTA GAATGCTAAT CTGGTCATGA TTCAATTTGT TGAGCAGAAT ATGCCTTATG CCAGCCAGGC CACCTTGATA TCACCAGCTT TCGAGGTCTT ACCTGGGGAA CACGGGGTCC AGAACCTTGG GGAAGACTAG CTCCCTGTCG ATAGCGTACA GTGTCCAGAA GGTCACGCCC ACATTGATAG CCACTGGAAA GGCCAATGTA GCCATCAGCC AGTCCTTGAA CCTGCGAACC GCCGGAGGTT TCTTGGGTGT CAGCTCATTA GTGCCCACGA AATCGTTGAC CAGCGATACA ATATAGTACA GTGCCTGAAT TATCTGTAAG TGCAAGAGCA TTTGACGTGT GTGAGATAAT GCGAAAGCGG CTAGATTTGA AGGGTTGCTT AAGTGAAGTG GAAGGAATTA CAGTTAGCGA AAAAACGTTG CACAAGCATT TCCTGTACAA TTTCAGCGAC AATAGGAGGC GAGATGTGAG TTTGTTAGTA AAGCACTGAA TTTGGAGGGA TTCAATTAGT TGCTTTGCAG TGGAATGGTA TATATATATA TTTATTGTAA AAACTGCTTT AGCGAAAGTT CTCCATATAA GATCTTCAAA AAGCTCTAAC TTTTATACAC TGGAGACCTT GACAAATCCT CTTCATCACT CAAGAAAAGC CCATGATTCT AACTACTGTC CTATTCATTT TCTCTGTGTA TCTTAATAGA TGCGTGCGTA CAAGTAACAA TCGGAGTGAA CTTTAAACCA CGCTGCGTTC GTGATTCTAA TGGGAGATGG ATATTACCGC ATCCAGGAAC GTTAGGTATT TGAATTTGCC CCCCCAGGGA TGATGGATCC TCATCTCTGG CTCGCTGGTG GGGAACTGCA CGTAGTTGTA GTCGTAATAG ATGCCGTAGC CAAATTGCAC GACTGCCGTC AGGTGGAGCA GGGTCCTCAG AGCCCCGTAG ACGCCCTGGT ACACGGAGTT GCCTCGCACG GATGCCATTT TCCTGCTGCA GCTGCTCTGC TCTCGATTGA TTTTTCACGG CACCAAAACA CAAACAAACC GGTCTGGTCT GTCGCTCCGA AAGTACTACT GCTTGCGAGT CGGAACCACC CCAAAAAAAG GGGCGAGCGG TGGAACAGTG TGCCCGAGCC GAAGCAGGGC CGCAATACCA GGTGTTCGGA TATACACATA TATGTATGTA CCCCCTTGTA GGGTTGTAAG CTACATCGAG ATTTAATATG AGCTAAAGTT TTAACATTTT GATTGTGGGC TGAATACATC TGTGAAGATG TGGATTCATT TTAAATTGTG ACTAGCTTTG TTGAATTTGT ATGAATTTTT TGTTTTTAAT TTATAAATTC GTGATGTAAT TTTATGAAAA TATTATTTTC TTCAAAACCA TTCAGAAATT GATGTTGAAG TCAATTCTTT GACGATAATC ATGAACGAAA TCTAAAATAT TCACTCTCGT CTACCGTATG AAGCCACATA TCATTCAGGT TGTATCAAAA TACATTGTTC TAGGCCAAAG GTATCTTTAC TGACTACAAG CGATTAGATT TGAGTGTATG GGATCGAACT AGAACATCAG ACCATTACAA ATCAAAAACC AGTTATGCAT CGCC