Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT022272
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 207136
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 222272
Nearest Genes
Gene Nr FlyBase ID Distance
CG3340 FBgn0001325 13177 bp
CG9380 FBgn0035094 22427 bp
Sequence Length 2177
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TAGGGTGTTAGAGTGGGCGTAGGGA
Right Primer ATTTTCAGTTCGGTCGGTCTGGTGG
Template genomic
Sequence TAGGGTGTTA GAGTGGGCGT AGGGACATGG GTCAACAAAC CTGCACATAC TATTCGGATG TTACATACTA TTCAACGAAT CTAGTATACC CCTTTACTCT ACGAGTAACG GGTATAATAA TAAAGCATAT TAAAAATTGG GTTCACCCTT TTAAACATAT AATGCATAAA AACGTGGAGG ATTTTAAGTA CATGAGGCCT TGCAACTTCG ACTGAAAGGC GCCGCAAAAT TTTCAACATA CCAATGCATT TTTTTGTCCT AGTCGTGCCA CTTTATTACC TTTCTATCTT CTAAAAATTA AGGATCCAAT TTTAAATCGG TTATCAACAA AAGACAGACG GAAAACAACA CATAAATATG ATTGGTCATT ATTTTCCATG TATCCTGATC TACAAATGAA CAATGTTTGT CGTTGGTTAA CACAGATAAC GCACATGAAA GAAAAAGCGA ATGCCGGCAG ACTTACAAAT GACTATTACC GCGCAACGAA AGGATTCCCA ATGAGCACTT CAGCACGCTT AGACATTAAT ATTTACAAAA GGATAACAAA TGTCGCGCGT TGTTCACCAA AGAAAAAAGG ATGTTTGTCC TGGTTGCACG AAAACGCAAT GCTGCGGTTG ATAACAATAA TGCCCAAGTG CGATTTGCTT AGGACCATCT TCACTGGTCT GCTATTTGCA TTAGCATTAA TTTTGTGAAA TTTTTGATAA GACCCACGGT TCAATCAAAG ATAAGTTTCG GTCACGGAAC CGTACATCGT TTGTGTTTCT CGCTATTACA GGATGCAAGT GTGTGTCTTA TACAGGTGAA ATCATTTTAA AAGCGAGAGG TGGAGGCTTA CGTAAATTGT TTTTTAGGCG TTTTCCAGGA AACGGTGTCA AAGTAATGTT TGCCTGTTAC TCCGTCTGGG AAAAACGCAG CGAAAGTATC TCTAAAGGGC GATCTTACTA AAAAAAAATT ACAAAATAAA ACTTTATCGA TAATTATTGT TTCGAAAAAA TTTATTTTTT TATTACGACC GGTTTATTGG TGGACGTTCA AAATCTCATC TTAAAAAGTT TTTCAATAAA AAAAAAAGAA ATTTGTCAAG ACACTGTAAG GCTCACCCCA GATCTTAAAG TATTTATTTC AAAATTGGCT TGTGGAGTAA ATGCTTTTGA TTGTCAAGGC ACTCAGTGTA TCTCAGCGTG AAACGCTACA TTATGTATTC AAATTTTTAT GCGATTATAA TCTTAAACAC ACGGTCATCT GCTTTTCACA GCAAACATCA ATCACGAAAA CCAATCGTAA AGCAAATGAT TAATACGATA TTTGAGCGAC TTAGGCAAAC GGGTAAACCG CTTCAGGATC ACCTAAACTG GTTCTACCTG TGAACTCTTT TGACAGCAGT AAGGGTGACA TATTAGCCAC ATTAAAATGC CACAGGGCAT CCTAAACGCA TACTTGAATT TTTAACCCCG TCTTAGAAAT GTTAAAAAAA AAAAGGACAA GGAAATGAGA ACACATTATC AAGCAATTCG GGATCGCTTC CCTTGGCCTT GTTTTCTATC CATGGCACCC CTTTTTTGAC TCTCTCGCCT TTTTTTATTT CTTCGTCTTC GTCTTGATCT TTTAACCCCT AATTTAGTGA TCAACGCCGG ATTTTATTCC CCACTTCAGT TTAGTTTGCC TAAACTTCCT ATGCAATAAT GAAGGGGTCA CAAGCGCACG GGTATTTCAA CTAGAAATCT CGGCATGTGC GCTGTATCGG ATCCGAATTT TCGGCTTGCT ATACTTTTAT ATATTCGAGG GACCGGGGCT AATACCATAT GGCGTTTATC GTCTTGACGC TCTGACGTGT GTCAGTCTCG CGCCCAGAAG AACTTTCGTG TTGATTTTTT GGGGTTAATT TGTTTTGCGA CTCTATTAAT TGGCTGCGTT TTGTATTCTT GTAGGCGTTC TCCACTTAAA ATGGGCGAGC ATTTCAATCA AATAACTAGA ACTAATTAGC TACCCACAGG GTACCTCTTA GAACGAATTA ATACATTGAT CGAACTTCCT GTTTCTGTAT TGATCATCGA TGTGTTCGTT CGAACATTAA TATCAATATA TTTTTCAATA CGTAAACATT TATTCTTTCC TCTTAACTAG TTGCATGGTT CGTTAGCTTC ACCCACCAGA CCGACCGAAC TGAAAAT