Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT027678
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206836
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 227678
Nearest Genes
Gene Nr FlyBase ID Distance
CG6494 FBgn0001168 8819 bp
CG6486 FBgn0035922 17708 bp
Sequence Length 2090
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer ATCGCCGAAATTTGGCCAACAAC
Right Primer GGGTCAGAGGATGGCAGAGCAGAAA
Template genomic
Sequence ATCGCCGAAA TTTGGCCAAC AACTTATGAA TCTGCATATT TTGGCAATAT GCGCAGTCGT CCTGCTGCTC GACATGTTCC CATTTTTTGT TCTAATTATT TTTTATGAGT TCAGTGCACG CGCAAAAATT GTCGCACTTC TTTGTGGCCA CCCGCAAGAC GTGTTTTTCT ATAGATTTTC GCATTGTTTT GGGGTTTTTG TTTCTATTCA TGATTTTTTA TTTGCCCCGA GCCCTGCTGT TCTTTTTGGC CCTGTTTTCT TTTTTGTGGT TAGAAGTGGA CCCAATTTTT AGCTAATAAT TGTTGCAATT TTTGTGGTTT TGGGCCTGTT CAGAGACCTG TTCTGAATTT AGGGCCGAAA CCAGTCAATC TGGACTAGGT AGCAGCTGTT AAAATTAGAA GTGATAATGA GGGCTACGCA AATCGATAAT CTTTTTTATT AAATCTTTTT TTTTTTTTGA TTCTATCAAG ATTAAAAGAT TTTCAGCTGT TTTTAGTATT TTTCTTCCGA AAGAGTGTCA CTCCTTCTAC TTTAACTCTC GCTCTCAGTT TGCCTTTTAC CTTTTCGACT AATGATCAAC TTTAACGTTT GCTAATGACA ACTGGCCAGA ATCGGTCCAC CTTTAGCCTT GACAAATCGC CGTGGCTTGG TGACAGATGA GGAGTTTTAA CTCAGCTTGA AACCGAAACC TAAAAACCTA AAACTCACCA TCATGTCAAC ACTTTCCCTG CCAACCATAA ATACTCGAAA AACCCATAAA ATCACTGAAA TTCAGACGAG AGCCGGGCGA AACCCTTTGC CACAATTAAA ATGTTAAACT GGAGTAAATA TCATAAAAGC AATAAAAATC CCCTAGACGC TAAGAGAATT GCTCTACTTA AGCCGAAAAA TGCGTTGCTC AAAACAAATT CCCAAAAAGT TGCCTCAAAG CAAAGCAAGA CTAATTTTTA ACAAAGCAGA AAAAACACAA AAACTCTGAG TCAGTTCTTC CGGGAACCAC GGAACTATCC GTTCAAGGGT CACCAAAGGG TTCGTGAGGA TCTGGAACGA ACACCCGAAC TAGGTCACTG GATCGTTGGG CACAAAAAAC GCACAATGCC GGCCAATAAA AAAGTAGAGC GCATCGCAGG ACATCATTGT CCTGACCGAA ACCCTTTCTC GGGTTTTACG ATACAGAGCT GCTTTTTGTG TCCTTTTTTT TTTTGGAAAC TTCTTCATAA TTGTAGCAAA AAATTAGTGC ACATCTTTAG AATTTACATA GAACTCGACC TTCGTTGACA CTGCGTTTAA CTTTTGATTT GGCATCTTGA CTGAGTTCGA AGGAGAAGGG GAAAAAAAAT GTAAAATGGT GGCGGGAAAG GCTGGGTAAT GGCTTTACAA CTTGTTGTCT CTAATTATGG TCGAAATGGG CCGTAATCCT TTGCTAAACG CAGCAACACA GACCGCCCCG TTTCGCCACG AATTCCAGTT CATCCGAGTG GCCGAATCCA TTGAGTTCCC GCGAAATCCG CGTCATGGTT AAACGCGACT AATCCTTCCC GTAAGCCCTT CGCAGCGACC TGAACCCGGT TCAGTTCACG GCAGTTCAGT TCGGTGGGCG TTTTTGTTTA GTTTCGAAAT CAAAATATTA GCAAACACGC TGAAGGCAAT ACGGCTGAAA GGGAAAATGT GCAAGGATTA AGCCGAACAC ATCCTTTCGC AACCTTGGAC CCTTCCACGT TCGCGCACAC GCTCGCAATT TTACGACTTT CTTCTAACCC GAATGCGATT TCGATTCCGA CTTTGGCGAA AACGCATGCC AAGCGCATGT CCTTGCCACG ATCCTAAGAT CCTCGATTGT TTCGTCCTAA GAGTTGACTT TCGTTTTTTA ACTCGTCCCG TGCCGAAGGA CAATCCTTTG CCGATTTGCC CATTGTTGCG GTTGTCTCGA CTCCTTTTTT TGCCAGAGGG TTACGGTCCA TTGTGGTGGC GATTGTCGCG TCCCCTTTGT GGCGAATTTC GACCCGGGAT CGCAGTTTTT TACGATCCTC AACGGGTTTT ACGACCTCCG TCCGTTTTTT AAGCCTTTCT GCTCTGCCAT CCTCTGACCC