Vienna Tile Information
VT ID VT024633
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206828
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 224633
Nearest Genes
Gene Nr FlyBase ID Distance
CG32296 FBgn0052296 35233 bp
Sequence Length 2100
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCGATGCTGACGACGAACTGTGG
Right Primer ATCTCAAAAGCATGTGGCTGCGTGT
Template genomic
Sequence GCGATGCTGA CGACGAACTG TGGCCCAGGA TGGCCGTCTG CTGCTGATGT TGCTGGAGTG TATTTGTATT GCTGGCGGCG AGCTTCGTGT CAATGGTTAT GGGTATGACA CTGGTGGCCA CCAGCTGGTG ATGCTTCTGC TGGGCCAGCT GGTGATTGTG CTGCTGCGGA TTCTGCTTGC TGGCTGCTCC TCCTGCTCCT CCTCCTCCGC CGGCTGAGCC CTGGAACCAG CTGGGAAAGT TGCCCTTGAG CGTGTCAATT AGATCCTGAT CGAGCGTTAA ACGCCACGAT GCAGGTCCGC CGTCCACGCT TTGCGTCGAC TCTGCAAATT AGAATTAGAA ATTTGAATTT TAAAGGTTCG AAAAGTTAAA TTGCTTAATA TTGATGTTAT ATAAATTGAA AATAATATAT TTTGTGGCTC ATAATTATAC CATTATCATT TTTACCCAAT TGTCAAAAAG CGCGGCAAAT GTACTTATTA AATAATTCAC CATAATCAAA CTTGTTTGCT AATGAAACAG TAAGCTTTTT GATATTTTAA AGACATCATT AAATATTTGC CATTGTCATT CCCGTTCATC GTTCATAGCT CACCCACATT TGATAGTTAA AGCCAACCCA ATTCATTAAT TTGCAATGGC TTAACACTCG GTGTTAATTT GATTTTCCAC TTTCCTCATC GGTCGCTCTC TGTTTTTCCT GCCCACGCTC ACATTTATTT ATTTGAATGT GGCTTTTCCG ATGATGTTCT GCTGCTGCTG CTGCTGCTGC TGCTGATGAT GTGGCCACTG GTGTGCTAGT TATTTATGCT AAACACTGCC AAGTAACCTA GTTTGTTGGC CCAATCCCCA GTCCCCACAG CCGCCCCCGC ATAGAAAACA TAGCAAAGCG CGTACTTGGT ATTTATTTTT CAAATTCTTT GCTAGTCGAT GTGTGCCTTG GGTTTTTTGG TTCTGCCTGA GATTTTGCGG CACTTTTTGG CTTGGGAATT GCCCGAGAGA TATACATAGA TTATAAATGT ATAATTGCAA TTTGCCGAAT CACTGGGCGC ACTGCTGCAC TTACTCGTAA CTGGTGGCGA CAGTAATGCG AACTGGCGAA CTGCGAGTGG CGAAATTGCG CCGAAAATCT TGGCAAGCGG ATGCATTGCA TCATGCGAAA GCGACATTCC CAGACACGCC TCATATTATG CAATATTCGG CGATATCTGG CGACTATTTA GAGCCGATCG GCGGCGAAAA TAGCTACCAT CCCAGCATAA TGGCCAAAAT CTATCAGCTC TTAGCCAACT GACATGCACT TGTCAAATGT CCACCTATTT CTGGCACTTA TTTTTGTTTC CTTTTCCTTT GATTGTTATT TCTGGTTGGC TTAAAAAGGT TCTCATACAT TGTCGCCCCC CGAATTTGGG TATTTTTAGA GATCTAGTGA GGATCACGAC TGTTACGCCG TCTGTCCCGA TGACTGTCCA GCCTACTGTC CCGTTGACTG TTCGTTCCGT CGAATGTTAC GACGATGGTC CCGCCGACTG TTCGTTCGAC TGTTCCGCCG AATTGTCGCA TTTAGGTCGC CTCCAAATAT CTTTTCTTAA CACTGCGTGG GCGGAGAATC TGTCACACAT TCTGCTTTCT GCCGCCTTGT TTGTTTATCT GAACTAAATT TGAAATTGCT CCGCAAATAA ATGGATAACT GTGCCGACCG CTGCATTTGC ATGCGCTGCG ACATTTATTG GTCATTAAGT CGAGCGCCAG AGCAAAAGAA AACCAGCAGG AAAAGCGGCA GCCGCTGCAA CAGGCAAGCA AACAAGCAAA CAAAACAAAC ATACCAGTCA TCCAACAGAG CAGCAACAAC ACATTGCCCA GCAGCAGGAT GCACAGAAAA CAATTAAGGA AACTCTTTAT CTTATGCCTA AGTAAAAGAC AATCTTTCGA GCGAACTTTT CAAAAGAAGT TCGTAGATTA GTGAAACATC AATATTATGT TTATATTCAA CTAATATTTC TCCCCGTGTA CCTTTGATGC ATGCCCCAAT GTGGCGTTTG GTTTTCTCTG TGTGCGATGG CGCGACATGA TGTCCACACG CAGCCACATG CTTTTGAGAT