Vienna Tile Information
VT ID VT002670
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206653
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 202670
Nearest Genes
Gene Nr FlyBase ID Distance
CG14029 FBgn0016076 12 bp
Sequence Length 2135
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TTTCTCAAGTGCGCTGTCTTGTGGC
Right Primer CCGCTGCCTTTGCTGATTTTCCTCT
Template genomic
Sequence TTTCTCAAGT GCGCTGTCTT GTGGCCAGCG ATGAAAACAC ACAAAGCCCC ATGGATTTCT CAGCCGTTCT GATAAGAGTC ATAAATACGG CTAAGTAGGT GTGCGTGTGT GTGTGTGCTT ATGTGTCATA AGGTGAAACG CAATAGACCC CAAAATCAAA TAAATTTGTT ATATCAAATC ATAAAGTGAA TCATTGAAAT TGGGGTAAGC TAACTGGGCT TCATAGTGTC GTATTTGTTA GTGGTTTGTG CTAGCACACA TTACCAATGT ATTTAATCAA TTCGACCTGC GTTACACTGG GCACTTCTCA AAGAAAGTTC ATTGTTCTGA CTTTTGGCCT TCAAATTTCG TTGCCCTATT GCGATGCGAA AGAAAATTTG TTAAATTATA TATATATATA TCAATGGATT TTCTTCAGAA TATGTTTAAA TATATTTTAA TGGCTTGCTA TGTTTTTTAG AATCACTTTT ACCGAATGAC AGATCGATAT CATAATCGGT TTGGATTAAC GGTTATTTGA GGGGGTCAAA AGAAAGCTTC GAATTGGGGT TCTGCATAAT AAATGGGCTA CCGTTATCGG TATACATTTC ATGTGTACAA AATTTCGGTT TCGTTTGCCG TTTAGAACGG AGTGATATCA AAAGTTTTTT TGGGGCTAAG CGGGGAATTG CCCGGGTGGC GGGGGTTGGG GGTTCTTCCA AAACCGGGGG CCTTTCTTTC TCATGTGTGT ATGTGTGTGT GCTAGACGTT TCGATGTTGT GCGGTGTGAA AGTTGTAAGC TCCGACAGGC CGACAGAGGA GGAGCCAGCG CATATTGTTT GTGGCCACTG TTTCGGTTTC TTCTGCCCCA ATGCTTGTTG TTGTTGTGGC TGTTTCCGAG ATTTTTCGGC CAAAGAGGAA GAGCGCGCGT GTGCGAGCGA GTGGGCAATA GAGCTGCGTG TGCGTCTGCG GGAAGTTCAT TCACATTTGC ACTCATTACG CGGCCAACGT CGCCGTCGAC TTCGATTTGG CCGTTGCTGC TGCCCCCGCA TTGAATCTAG AAATTTAAGC AGCCACAAAG TGCAGGCGCC ATCTGGCGGG AGGTTTGGTA AAAATAATAT ATTCATAATA TTATAAAAGC TATAATTATT CTAACTATAA TAAGTAGATT ACTTGCAGTT TCTTTGCTTA AAACTTGGGC CATAATACTA CATTTCATAT TTTAATAGAT GAAATATAAT AGATATAGAC ATATACATTT TTCTGCTTAA AAAGCTTTCC AGCTATTAAA TTGGGGGATA TACCGAATGA TTTTTATCTG GGAAATGGCA ATAGAGCTGT TGATTATTTC CCGCTTAATT AAGTGCGCCT CGGCGTGAAC CCTTGACCCC TGACACCACC GAGCACCGCC CCTCTAAATG ACATTTGGCG GGCACGCTTT TCATCACGTT GCCGCTTACA GGTGTCCGAT TGATTGCCAC GGCTAAGTCC ACACAATTGC TGCACCCCGT CGTCTGGCGT TCGTTTCGCC GCCCCATCGT TTGTGTGTCA TGTAATAGGC ACAGCGGTAA TGTGACTTTC GAGTGCTCAG AGAGCCCCGT TTTTCCACCT TTTCCACCTT TCCACCCGAG GCAACGTGCC TGCTGCCGTA CAATGTTTAT CGTTCGAATG GTGTAAGCTA GCCAGCCCAC CATTCCCTCC TCCCTCACTC ACTCCTTCCC TTCCACAGCA ACAACCCCAA CATCCCGATC CCGTTGGCCC ACTCAGCCAA CCTCTACCAC CCCCCCCCCC TCAGGTGGGC CCTCAAACGC CTTAGTAGGC CAGCCAGAAA TCGCTTCGAA CCCGCTGTCA CGTTTGCCGC TCACGTTTTC CCAGCAGCGC TGCTTCAAAC AGGTTGCATG TTGCATCGAG GTCTGTGTGC CAGCGTAACA CTTGGAAAAT GGGGTTTACC TGGGTGGGTG ACTGTGCCAG AGGGGGCAAC CGGGCATCGG GGCATCGGCA TACGACCTGA TTGACGGGCT ACGGCTACGG CTCCGTTTCG GGCTCTTGGC TCTTGGCTCT GGTGACGTCC ACCACCGGTT GCTGTGGTAA TCATCATGTG GCCTGTTTAC TCACGTTGCA CAGCCATCGT AGAGGAAAAT CAGCAAAGGC AGCGG