Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT045229
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206570
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 245229
Nearest Genes
Gene Nr FlyBase ID Distance
CG6545 FBgn0011278 3672 bp
CG7922 FBgn0038889 30062 bp
Sequence Length 2274
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GGTTTCTATTTTCGGGGCCTGTGCT
Right Primer TCATACGCGTTACATTGCCTTTCTTTG
Template genomic
Sequence GGTTTCTATT TTCGGGGCCT GTGCTTTCGT CTCAATCTGT TGCTTCTTTT TTCCCGTCTA CGTGAGAGGG CCAAGCGATC CGCAGCAGAG CAGTTCGATC CGGGCCAGCA GCTCTACACT GCACAGAATA GATTTGTAAA TTTAAAGGTA TGTAACTGAA ACATATGCTT GTCAGAAGCA TGTAGCTGCT AAGAAACTGC TAAGTGAACT GATTTACATC GGAATCTTCA TGCTGTATCT GCTTCGGTAG CCCAAGATAT CTAGGTAGAT ATTATACATA TTATACATAC AGATTGCACA CAGATATTTA GTCTTTACTA ATTTACTATT TACTAATATT TAACATATTT TTTAGTATTT ACGAGTTCTG AATAGAAACT TTATTTCTGT GCTGCATTCC CTTTTCGGTT CTTACTTGAA ATACGTGCCA CACGGCGTAT ACGTATCGAG TGATGCTGCG TCAATACTCG ACACACTCGA CCCCCACACA TGTGTATTCT GGGGTCCCAG GGAACTCTTG TATTTGCATG CAACAGAGAA CACTGTTTGG ATACTTTTTC GACTGAATGC GGCACGCAAA TATTTGTCCG TTGGCCCCTT AATTGAGTTA ATAGACTTGG CCGAGAGTGC GCGTGGCCGG CGTTGATTTT GACCGACGTG TGATAATTAC AGCGCTGCCC CAGCTGCGGC GGCTTTGATG AGGCTGTCGA AGTGGATGCT ACCGACTGGT CCACAAAGGC GAGGGAAAAC AACAACAAAA AGTGGCATCA GCGGTGGCGG CGCCTTTGTC TTTGACTTTG CGTTGGCCGT GCTCAAACAA ACGGTTCAGT GGTTCATTTG GACTGCACTT TTTTTCGGGG GGTCGCTTGT TTAAATATTG AGACTTGTGT TTAACATAAT TAATGCGAGT GGAAATTACA GTGGCCCCAG ATCGACTTCC ACATCGAGGG ACTGACTGAC TCACCGGCTT ACAAGAGGAA ACAATGTTTT ATTTTTGCGC CGCTTGTCGG TCTTCTCTCC TTTTGGGGGC AAGTGCAATT AACATTTGCA TACAAAAAAG AAGTAATTAC ATGGCTGCGA CTGACCATTG CTATACTTTC ACGCAGGGTA TTTCAAGTTT GCAAGCGGAT AGAAGTACAG CATATACTTA TCAATTTCCA CGCTCCTAAG CGACTCACAG GCTAAGCAAG CATTCCTGAA GTATAGTATA CCAAAAAAAA AAAAAAAAAA CAAATAGTTA GTGCTTACTT TATAACCACT TCAAGATATT TCTGCGCATC CTGAAGTTAT TGATTGCTAC AATACAAATA TCCTTGTAAT GATATACCTC TCAGTTGTGC TATATATGGC AAATATCATT AGTTATGTCA TTAGCTCATA ATGATGCGGG TAACTAAAAG GGTATTCCGT CGACTTCCTA CCTAATTGCC CAGCTTTTGT TGCTAAAAAG GCCGACAGAG CGGCACAATT ACTTGGAAAG CTGAGACGCG GAAAGGGCCG GCGCACGTAT GAATATCAAA TCAACTACAT TGCAGTTAAA AAGCGCATTT CAAACACCTC TGAGCTGCAC TCGCTCGTTT GGTGGTCCAG AATGCCCCAA GAGCATTAAG ACCTGGCCAA GACGATGGGG TAAGTGGGGC GGGGGCTTTA GGGGGCTCAG GGGGCCCAGG GGGCTTAGAG GGCTGCGGGG TCAGACCACA TTGCTTGATT GCCGTGCGCC TCTCGAGATG ATGTTGCATT TGCGACGCTG CCCCGAGATC GGCTTCGAGC CACTAACTCA TTCGGGGAAG CCGTGGCAGG AAGCGAGGAA GGGTTTTTCT TTATTTGGCT CCCCTCTATA TCTCTCAGTT TCTTCTCTTT TTGCGAGCCC ATATGTGGAA AAAGCGATTC CGATTCCAGT TCCCTTCGCC GATCCAAAGT CGCTTCAGGT TTTGGCCTCA TCACGATGAG TTGGTTCTGG TTCTGGAAGT TGTACTGGCA ACAAAGAACC TGGATGCGGG AATCTATTGC CCCACTCTGT GCAGCTTCTT CTGCCTCTGT ATTGGTGCAT CAGCACACGA GTGTGTGTGT GTGTGGAGCA GAGCGCCATC TCGTTTAATG CCTTTAAGGC GTGACCATAG TATTTTATAA TATAAACTGA TCAAAGGATG CCGACGCGTT TCAAGTCAGC CGCTAAAGCT GTGGCGACTC CAGATTTGCG CGCTTCGTTC TTGGTTGCAA AAAGGTTGCG GCAACATACA CCGAAAGCAA AGAAAGGCAA TGTAACGCGT ATGA