Vienna Tile Information
VT ID VT016984
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206519
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 216984
Nearest Genes
Gene Nr FlyBase ID Distance
CG33467 FBgn0053467 7235 bp
CG11798 FBgn0015371 49653 bp
Sequence Length 2131
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCAGATCTTAACCCTTTCGCCAGCA
Right Primer AACCCAAAAATGGATCGAGTGGGAG
Template genomic
Sequence CCAGATCTTA ACCCTTTCGC CAGCATAACT AGTTTGCAAC AGTCGGCGCA GTCGAGGCGA TAATGTTATC TAAACAAGCA TAAAGTTTTG CATCAAGGGC TAAAAATCTA AATATTATTA CCAGCATCCG GTCGGCCAGA ACCACACTAC CCACCTCCCC ACTCCTTGCT ACCAACATTG ATTAACTTCA TATAGAACTA GTTTACTCCT TCTTGGCAAA AGTTCTGCAT CATATGCCCT TGCTTAAGGT GTTGTTACTA TACGGGCCAT TTAGAACTTT AATGTATCAC AGTTTCTATA TATAAACGAG GTACATTGAG GTGAAAGTCC ACATTTCTTT TATATGTATA TAAAAGTGAA AGAATATATT ATTATGAATT GTACATATTT AGAAGTAAAT GCGCAAAATG ACAAAGATTT GAAATAAATA AGATACATTG CATATGTTGC ATATATTTAC TTGTTATTTA AACTAAATTG TCGTGCAAAT ATTTCTTGAA AGGGCAAAGC AAGTTTGGCT TTTCAATCGA ATCTATTTCC CAAAGATTTA TTTTTAGCTC AAGCTGTTCC GTTGATTGTG GGCAATTGCC GGGAGTTGGC CAAAAGGGGC GATGAAGTGT GTGCCTTAAT TTGCCTAAAG GAAGTTGCTA GTGGCTGTTT TAAGAAAAGG GAGAACTAGT TGGCCAACAA CAGCATCTGA TCAACATTGT GGCTTTTAAT GTGGCAAGCG AGGCGCACAT ACGATTTCTT GCCCCAGTGG ATTTTAAAGT TTATTGCTAC GTTTGAGCGC ACTCCTTATT TATTTGCAGC AAAGGCAATA TAAAAGCCGG ATTAAACGTT TTATTTCAAA ATAAATAAAT TATTGATTAA TGTAGGGAAC GTCTTAACAG AGGGTAGTAC GTTTTGTAAA TTCTATTGGT AAACTGGTTA ATTAATGTAA ATAAAATTTT ATATAGCACC AAAAAATATG CATAGCTTTG AAACACTGAA AAAATATGTA AAACTTATAT CTTTAATTGT ATTTTTCTAA CACTTAATCC AAAATACAGA TTTGAAGTTT TGATCGAGTG CTATTGAAGC CAATTACTAA AACCGTAATT TCTGATTTCC TATTCCAATT GCGTTGAAGG CCTTACTGTG CAAATAATTA AGATGCCATA TTCCAGATTG CCATCCTGGC CATAAAATCG AGTAAACAGC TCCTCCAGAC GTTGCCACAA GCTGCATGCA AGCAAGGTTG GCTGATTGCA CACATGCACA TTTGGCTTAA TCCATGGCCA AGACCCAACA CGCCTCGGGC CCTATACACT ACAAGTTGCA GATTTCTTGC ATTTTATTAG CCAATTTTTT GTGTACATTG CCGGAAACGC TACGAAATGT TGACAACGTA CGACATGCGA CAAATGTGCC TGATTACTCG AAATTAGCTT TGATTTGCTG GACGTTGGTT GTGATGGGGG CAAAACGGCA AAAAAAAAAC AAAAAAAAAC GAGAGGGCGG GCGATAAGGA AGAGGGCTTG AAAAAATGTA CCAGACTGAC AATATGGCCA AATGGAAATT GCTGTGAAAT GTATGAACTA CCAATTCTGT TTGCAGCACC AACAGCAAAA ACCACTTTCG AGGGGCGGTG ATGGGTGATG GGTGATGGGT GTGATAGGGG GTCGCATAAA AAAGGGGGAA GGCCATCGAG ACATTGACAC AATAACACCT AAACTTGCAT TGTCCGCCCC GCAATATTGA CTGCCGGAAA AGTGCTCGCT GGCTTGACCA AAAGAGAGAT GGAAAAAACA GGACGGAAAA TGAAAACCAC TTCTGGTGAG CCCTTCGACA AAAAATCCAT TTTCCACTCA CTCACCCCAC TCCTGCCCAT GGGCCATTCT GAATTCATGC ATGAATTTTG AGAGGGAACA ATTTTTATAC CTTTCGCAAT ATTCCGGCAG TGTCTGCGCT GGTTGGCCCC TAGAAACCCA GCAGTCCGTT ACTTTTCAAT TTCCACTTTC CACTTGCGAC TTGGTTACCC GGTGTCTTCG GTGCGATTTT CCGCAACGCT GCATTTTCAT TACCATCAAG TAAATGGGTG CGAGCAGTCG AGCAAACTGA CTTTGTCTCC CACTCGATCC ATTTTTGGGT T