Vienna Tile Information
VT ID VT025342
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206470
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 225342
Nearest Genes
Gene Nr FlyBase ID Distance
CG14994 FBgn0004516 1796 bp
Sequence Length 2101
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CAAAGTGCGGACTCAGCAAGATAAGGAA
Right Primer TGAACAAGTGTCGACTTCATTTTGCCA
Template genomic
Sequence CAAAGTGCGG ACTCAGCAAG ATAAGGAAAA ATGGAGCTCG GCCAAATGAA GTGAGTCAAT GTTATGCAAT CGACCGAAGG CCGTGGGTCC TCGGGGCAGG TGTTACATAA GTCCTTGCAC TTCGAAAGCC CCCATTTTCC AACAACCCAC ACACACAAAT TGCATAACCA AGACAAGCAA ACAAACAAAC GGTGCGAAAA TGCAATGGGC GTGTAAATAA ACAGAGTGGA AAATGGAAAA TGGAATGCGG AGTTTGGCGA ACGAGAAGGG GGGGGGGGCT GTTGGTACAA GGACAACTGA AGGGCAAGCT CCAAGTGGGA GGTAAGTATT TGGTATATGC CACATATACA CGGATTTCAG GGCCCCTCCT TTTCACTTTT GGCGCCATCT GCTATTGCGC AGTGAGTGTT AAGCCAATTT CCTGCGACGG AACGAACATA TATAGTATAT ATATATATAA GCTTATATAT ATACATAAGC TTGATTTACA TGGGGATACA GACAGCGCGA CAGCTGCAAT TAATGGCGAA AACCTTGGAC AGTGCGAAAC TTATGCAACA AAATCGTCTG GGAGTCTTAC CGATAATCCT GCGGATATCG TCGATATACT GCTTTAGGTA ATTCACTTTG ACTGTCTGCG GGGGGCGACG AATCACCGAC GAGGCTTTCG AAAAGATATA GCTAGAGGAA TGTGCGAGTA CGAAATGTAT CGAAATGTAT CTCTGAGATG GAGCTGCGAT TAACTACTTG TGGTCTAAAC CAACGACAAC TTACAGAGTT CTCTTCTTCC TAGCAACAAC AAAAAACACT GAAAATCACT CGCGAAACGG AGGAGCAACA ATTCGCTGAT TGAACGGACT GGGAATTACT ATTGGATTTG AAATGTATAT ATATTTTCAC AGGTTCACAG GTTTCGGGCA ACTTTCACTT TCGGTTTGGG AAACTTAGGG AACTGAGCAG CCTACACTCG CTGACGATCT GCGGAGCTAT GAGCAGCAGC ATCCGCCTGA GTTGCCTACG AAGCTTTTCG CATCCAAAAA ATGGCTGCCC ATATACCACT ACAAGCGTAC CTATGTATAT ACATACTACT CCTCAATCTC TTGCATAACC TTCAGCGACA ACGACAACAA CAGTGGGGCT GAGGAAAATG CGGGAAATTC TCCGGGTGAC GTCATTGATT TTTCGGAAAC CATCTTTGTT AAGGCCATTT TGCGTGGGCG GAGCTTCGGC CATGCGCGCC CCAAAGTATC CAACAGATAC ACATGAAATA TGTGCGCACG CCTGGTGAAT GCTAAAGAAA TAATAAAACG GGATAAAGGG AAAGGAAAAT ATAGATTGTG ATGGGGCGAC CAAATGAAAA GCTAATTAAC AAACTAATTT TGCCACTGTT TCTGACATTT ACAATGACCC ACAACTTTTT ATGAGAGTTT CCTGTCGAAT GAAACAAAAA AAAATAACCC TATAATTACT TTCATTTCCC GCATATATGT ACATATGTGC GCTTAGATAT AGAAGCCAAA GCATATAGAT TCCTGGTATA TAGAACAAAA ACGAAATTTG GGTCAAAGCT AGGCCGCCCG CCCACTTGGG CTATGCAAAA TAGATATGTA TCTCAGAGTG AAATTGCATC ATTTCCAATA GAACGCGTTT CGTAGCATAC TTTTGAGGGC CAGAGAACAT CTATGGCCAT GTTATGCAAC TTGGGTAAAG AGCCCAGGAG CAGCAGGACC AAAAAGGACG TCCATCAAAC TGGAGAAGCT TAAACAACGA GAACCCTAGG AATACTTGCC GCAAAAGAGT TCCACCCACT CCACTTCCAT TCTTATCTGA CACACGGAGC AGCTGGCGTA GGATGTTACC ACACACTTGG CACTTGGCAC TTGGTCCTGC TGCTGCTCCA GCTCCTGCTC CCTGGGCAGG ATCCAATGCG TCAGCGTATT TTCGTTGCGA GGGCTCTGGC ACTTGAAAAG TGTCTTTCGA TGTAACTGAT TGCAACTTAA GAAGGCCATT ACAGTGGCAA TAACTCCCTT GCTAGTCCCT GTGATCCATC TTTTTTATTG AATGCCTGCA ATATTGGCAA AATGAAGTCG ACACTTGTTC A