Vienna Tile Information
VT ID VT014368
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206465
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 214368
Nearest Genes
Gene Nr FlyBase ID Distance
CG2328 FBgn0000606 5943 bp
Sequence Length 2083
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGGAAATCTCACTATGGGTGTGGGTG
Right Primer GTTTTACGCAGCTTCTGGCGGTCGT
Template genomic
Sequence TGGAAATCTC ACTATGGGTG TGGGTGTGGG TATCTGTATC TGTATCTATA TCTGTTGCTG TGATGAATAA ATAACTTCTT AATGGGATGC TGCTCAAAAT GGCTCCCACT CATCCCCATT GGCGGCTGGG AGAGTCGTTG GGCATCCGGA AGCGGGGGCA GCCAAAAATA TACCCACATC CCATGGATGC CATCAATTAG CATACAATTA AAAAATGCTT AAACAGGGAA ATCGTCTTGG GATGCGAGTG GTTCGGCCGC AGATGCAGCC GCAGCAGCAT TTGTATCTCC AAGTGGCGGG CAGCAGATCA AAGCGACGAC AACATAATTG CTGCTTCACT TCACAGTTCT CAGGCACTTA AGATATACAT ATGTATGTTG CATACATATC TATTGCGAGT CCGGATCTGC AGCTTCCCCT ATCGATCTTC CCTGTTTTTT GTCTGACTGA CTGACTGCCG GTGGGCCCTT GAGAAGCCAT GGCGCCTGCT AATTGAGATC GCGGCGATCC TTTGGATGCC CACTTGAGGA GTTGTCCTTT AATGGGTGAG GCGCGGAAGT GCAGGACTTC CTGGTGTCCT TGAACGACCG GAGCTGATCT AAATACGGAT CGGAATTGGG ATCGAAATCG GGATATGCAC AACACGGTAA TGATAAGCAG GAGGATGCAC TGTATCCGTA CCTGAGCCCA CTGATCCCCG GCAAGTCCGA GACAAATCCA CAAATATTGT CAACTCTTTG GCTCTAATCT GAGGCCTAAT CACTTCCCTG AAATGCATAA TTGTGCCGCG GCTTTTGATA CGCTCCTGGC GGAGAGGGAG ATGAGGAAAG GATGCACGGG AACCGCAGCC AAGTGGCAGT CGAGATTGGC AAATCCGCCA GCGGACAATG CCCAGAGAAT GGGCAACAAG TAGCGGCGAA TTAGCAATCC TATCATGCTT TTATGGCCGG CCAACTCTTG CCCGCGCATC TCAGTTCATC CGAAGCGGGA CCAGGTCCAG GTTCAAGTCG AGGTCCAGTA CCCCTGCTAT CCCGTCAACC CCTTTAGGGC GATAATCCTT CTAAATGTTT GCATTAATTT CGAGGCGTGG ACGGATTAGG GCGTGCTGGC TGGGCGGAAC CCGCAGCAGA AACCGCCGAG GACACTGCAC CGACTGACCT GCAGCCTACA GATCTCTGAT CTTCGATCTC TAATCCTTTC GCATTTGCAA CTGACTTCTG CACTGGGTCC GCCCCTAATC CTTCCGCCGA GAAGGCGGCA GAGTCGCGAG GTACTGGCCC GGGGTAATGG GATTATCTGC GATTACCCCA GATGATCCGC AGAAAGTCAA TCTGGTTCAG GGGCTAATTG TCAGCGAAGT CAACTAAATC CAATCCTTTC GCGCCCCCTT CTGTTTATTT GTTTGTTTTC GTTTGTTTTG AGAATTTCTG GCAATTAAGT TGCCCGTTTT GATGCGCGGG GGCGGGTGCA TCAAATCCTT TCGGCATACC TGTCCTGCAC AAATGCTGAA TTCCGCATCC CATGGATACC CAGATATTCA GATATCCCAA GGCCGCAAAG TCAACAAGTC GGCAGCAAAT TTCCCTTTGT CCGGCGATGT GTTTTTTTTT TAGCCATAAC TCGCTGCATT GTTTGGGCCA AGTTTTTCTT CTGCCAAATT GCGGAGATGA TGCGGGGATT ATGCGCTGAT TGCGTGCAAT TATGGACATC CTGCGAGGCC CCGAGGAACT TCCTGCTAAA TCCTTTCATC CGCCTACAGA ACCCCTTTGT GTCCCGTTCG CCGGGAGTCC TTGACGGGTC CTTCGACTAT TCGCTTACAG CAGCTTGCGT AAAATTTCAT AACCCTACGA GCGGCTCTTC CGCGGAATCC CTGGCATTAT CCTTTTTACC TCTTGCCAAT CCGTTGGCTA AAAAACGGCT TCGACTTCCG CGTAACTGCT GGACAACAAA GACAAAAAAC GGCGAAAGGA CGGCGATTTC CAGGTAGCAT TGCGAATTCC GTCAAACTAA AGGACCGGTT ATATAACGGG TTTATATGGC CAGAATCTCT GCATCTCCAC GACCGCCAGA AGCTGCGTAA AAC