Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT054827
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206428
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 254827
Nearest Genes
Gene Nr FlyBase ID Distance
CG32816 FBgn0052816 47334 bp
Sequence Length 2108
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGCGTCCTAATTACCAGTCAGTTACAGTTCCA
Right Primer TGTGATTATCTGCGGCCAATGCCTA
Template genomic
Sequence TGCGTCCTAA TTACCAGTCA GTTACAGTTC CACATAATCA GCAATACGGG ATCGACGGCC AACTGAATAA TGTATGCAGG TCTGAAAAGC TGGAAAATGT GCAGCCGCAT TAACGGTATG CTCCCAAGCT TTCATGCTCA AATCGAAGTC CCCAAATCAA TCTTATATGC ATATTGCGGT AAAGTAGAAG ACTGCAATCA AAAATCAATT CATAAACAAT TGCAGCGTCC AGACGGGAGA CGAAAAAGAA GCCGAGGCAT GGGCTCAATC AAATTTGTTA TAAAACTGTG AAAGTCTGCG ACAGCGATCG GAAACAGGAC TCAAAGTCAA AGGCACAGAT ATATGCGATT TGCATGCGAT TGAGGCAACA TTATGCAAAA GATCGGATGC CGCGCTCATT GCTTTGCATA CAAACCCCAA TTCTGCGATT CTGCCCTGTA CTTTTGCGAT TCCCATTATC AAGTCCAACC GAATGCAATT TCGAACTGAA TCAAAGGAGC CCAGAATTAA TATCAGTGCC TGGCAATCTT GTGTCTGCAA CCCCGACACA ATTCAATCAT TTCGCTTCGG ACTCCCTGGA AACGTGGGAC GACCGACGAG GTCGCTTGAT CTTTAGCGCT AGATTAAACG ATCAGCGGAG ACAGCCACCG AAAGACGTAG TCGTCCTACG AGTTTGACAG TCTACACAGA AAACAATTTT GCTTCATAAT GTTTAATAGT GATCGCCACA ATGTGGGACG TTATAAAATA TCATTAAAAA CAATATACAA ATATATATAT TTCCAAAGCG TGAAGGAAAA ATATGCACTG AAAATATCTG ATTGAACATA TCGTAATGTT TTTATTGTCG GTGTCCAAGT CTGGAAAAAA CTTAAAAACT CAGATTGTAC TTGCATTTCC CGCCAGCAGC AGCAGTTCAC CGATTGTGTA GGTTGATCTG GGATGGATCG GTCGTGGACC AAGCAAATTA TTTCACTTGC GCCAACCACT CGAACTGCTG GTGGTCTCAA TGTACAACTT GATTTCTGTT TCCTTTGCTG TACTGGCAGT TTGATTTGTT TAAATTTAAT TATGCATCGA TTGTCGATCG CCGATCGCAG CGTAGGTAGA TCCGTTCCCG GTGCCCGAAA AAAACGACGA GACATCTAAA GGGAAAGGAC AGGACAACAG AGCACAGGTG AAATTATGAT GGTTGCCAAT GTCATGCCGT TTCTTCCCGA TCTTGATCAG AGTTCTCCGA TTTGATTATC ATCGTCGACG TGCTGATCGT CAAACCGCCA AATGATGATC GATGCCAATG TGTTCTTGGC CCTTTCATGC TTTTTTAACC ATTTCTGGCA CAGGGCGATT TACATTTTGT ACTCCGATTT CTTTGGGAAC GTATGAAGCG ATCAATCAAA AATGGAAACA GCCAAACGAT CGATCGCCAA GGGAAGCTGT GGCAATTCAA AGAAGATCCT GTGACAGAAG ACAAAACAGT TTATGAACGT TTGATGTGAG CAATGTGATA AACTGCGGTT TAATTTCATT GTATGCATAC CGGACATATG CATGAACCCC AGAACCGATC TCATTCGAGT TAGTCTTATC CGATTCGGGT CATAACGATG TCAACGCGTG ATGTACAGTT TGTTAGAATT TGAATTGTTC GGAGCGCATC GTAAATTGCT GCTGAGGATC AGACAGTTAA GGATGGGTTG GCTTTTAAGG GCCAAAGTAA AGGCGACTTT TTTTTTATGC TTTTTAGCTT TTATCTTTAA TAAAAAATTG CATTTAAAAA TGTTGACACA TGTTAAATAG TAGTGCGTTC AAAAAGCTAT TTAACCATTA TATTTTAATA AAAATTTCAC CGAGGCTGAT CACCTGAAAT TATATTTTTT CACACAAGCA AAGCTGGTAG ACCGATTGAT TGATGGTTGC CAATCGATTG GGTGACACAA TTCTCGAGCA TTCATTTATT TGTCATTTCC GCCCAGTTAA AGTCCAATGC AATGTAAACT ACTTGGTTAT ACAAATATAT GGGCTAGATA GTGAGAAATG CCACAGAGAT ATCTTTTAAA AATTATAAGA CCCCATATGA GTATAGGCAT TGGCCGCAGA TAATCACA