Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT050230
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206423
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 250230
Nearest Genes
Gene Nr FlyBase ID Distance
CG12073 FBgn0004573 18954 bp
Sequence Length 2106
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGAACCTGCACGGATTATTGGCATT
Right Primer TAATGGCGCAGGCACACACACATAC
Template genomic
Sequence TGAACCTGCA CGGATTATTG GCATTAAGTA AGCCAGCCAG ATAATTATGC AAATTTCAGA TTCAGCTTCA GCCATTTTGG AGCTCCACCA TTAAAGACCT GCTTTTTGGC CAACACCCCA ACTAATTGCC CAACGTCGGC TACAAATTCC TCACTCGATT GTCTGCAGAA AACAAATTGC GCCTGGCAAA TAAATAATGC ATGGTTAAAG CGACGGGGAT TCAGGGGTAA CATGCAAATG ATGGCGGGCT CTTTCTACCT GCAAATCACT TTGAGTTATT GTATTTAGCC TTCAACGTTT CCCGGCAAAG TAGAATAAAT ATTTTAAAGC CTCGCGCCGT CTCACCTGCA AAAGGTGTCC AACAGCCACG CACTTTGGGC GATGATTGAT ATGGCTTTTT GGGGGAAATG GAAGACGGTC GGCTCCCGGG GGACGACAAT TCCCCTTTTC AAACACAGAA AACGTCGAGT GTCAAAGTTT TTGTGCGCGC TTAGCGCATT TGATGAATTG TTAAAAGAAA ATCGCGCGTA TGTGTAAACA TTCTGGTCTA GAAATTCGAA GGGGCTGGAA CCTTATGAAT GTGTGTGTGA AAATCAACTG TACTACCACC AGCCGCTATG GGGGAAAAAG TCTGGCGAAG CTTTTGAAGC CGCCGACGAG CAAATGGCGG AAGCCCAAAC AGCTGCTGAT GATGATGGCG GTTGCTGTCG GTAAACAGAA AGAAATGAGT GGGTAACATT GCGGGAGCAC TGACTGGTTA ATACCCTTTG TCCGCAGGCA TCGAAGATTA CCCACAAATG TCAACAAAAT AAATTCGACG ACATTTAAGC CCAGCGAGTG TTATTTGAAG GTTGCTAATT GAGTTACCCT ACTCTCCCAT TCATCAGGTA AGCACTTTAA ATAATTAAAT GGCCAATTGC TGGCACGCGA GTGGACAAAG GTCTTTCATT ACTTTTAATA ATTTAGTATT TTAGCAGCTT TAGCCAACTG GAATCAAGTA GATTAAACAG CCATTGGGAA ATGACGTGAC ATTTACCCAA TGAATATGAA ATATAAATAC TTATACACTC AATCGGAGCT AAATTTAAAG CCAAGAAAAT TGCTTGTGTA AAGATTGGAA CTGACAAGTT TCCGGATTAA AATAAGTAGA GCAGGTGAAT CATTGCCAAA GTTCTTGTGA GTTTTACCTT GGCAAATCCT AAGGTAATTT TCGTAATGAG TCACTCGCCC AGACATTTCT ATGCTAATGC AGCTAAAATT AGCATGAAAT GTGTATTTAC TTAGTGCTGG TCATAGGATT ATTTGTGGCT CAGTAAGGGT ATGCCCATTC AGATAGCAGG AAGCAAAACT TTTCGCAGGC CCTTCACTTT TAATCTGCCT TAGACCGACC AATACACACA CACGAGCCTG GGCAAATGAA TATATGCATA TGTGGGCTGT CATTGCCTTA AAGAGACAGG ATCCCCGGGA TTCCTGGTAT TTGCTTGGAT TCTGCGTGGG CACCTAATCC TCGCCAGAGA AGCCACATTT GGCTGGGCGG GAAATGGAGC GACACTATAC ACATCAAATC ATCAATCACA TGCTTTGGTG ATTCATTGAT AAGCCCTCCC CATCGAAGCC CTCCAAGGAC TCCGCATGCG GTCCTCGTGG CAATCATGTT AATAATGCCG CAAGATGTCG GCCAGCCATT AGCCTTCGCC ATTAGGCCCT CCACTCTCCC CTTTCCACCT TCCCACCTAT TCCATTTCCC TTTCCCTTTT CTGACGGCAA TTAATTTAAA GAGCTTTAAA GCAAGAGAAA TGAAATGCAG AGAATGGGAC TTTGTTTATT TTGATTTTGG AAATCAATTT TGAATTTGTT GTTTATTTTT GATGTGGTTA TCCGGCCAGC AGCCACTGGC GTGTAAACAA ATCGAGCGCT TTTTTTCGCA GATGCCACGA ACAGACAGGC TCTGCTTTTT GTGTGTTTGT GCGTGCCTCG CGGAATATAT ATAAATATAA AAACTATATA AAAGGCAAAT ATTCATGCGG AAAATATACG TATGTATGTA TGCTGCGTAT TCGTATATAT CATGAAGCCG CGTATGTGTG TGTGCCTGCG CCATTA