Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT034389
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206383
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 234389
Nearest Genes
Gene Nr FlyBase ID Distance
CG7807 FBgn0023417 13471 bp
Sequence Length 2179
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer TTACGTGCGGGCAAAAGACCAAAAG
Right Primer TGGGTATCTCCTTGGAAAATAACAGTTCCAG
Template genomic
Sequence TTACGTGCGG GCAAAAGACC AAAAGAAACT GGACGAGCAC AATAAATTAT TTAGGACGAC TCGATCTCAC CCCCGAATCT GGACCGCAAA GTTCGTCTCG GAATCTGAGA ATCTCGGAAT CTGGGGAACT GTGGAGCGTT GGAGCGCTGG GCGCTGGGCA GCCCGACCAG CTCCTGCGTG GCTCCACTCG TTTATCTTGC CAGCAGAAGA CACCTCGGAC ACTCAGACTT CCAGACCAAG TCGGAGCTGA AGTCTCAGCC TCGATAATTA ACACACAAGC GCGGGGCGTG ATGAGCAACG GACCGCAGAA CCAAACAAAT TATTAAAAAT GAATTAGTGG AAATATAAAT ATATGATTTT GAAGTCCCAT GAACCGCTGG GGCCACGTGC TTCTAGGCAT TCACATCCAC ATCCCATCCA CATTGGGCCC TGATTGCGCC GCTGGTCAAG TTGCCTTCGG GGTCGCAACT CCCAGCTCCA TGCACCCAAC TCGACTGCAA TTGCATTTGA ATGTTTTTCG AGGCTTCGGC CTCTTTTTGT TTAAATATAT AAAAGCCATT AAATACTAAT CTATTCTCGA TTGCTCTTCT TCGGCTTCTT CGGGCACCTA ATGACGCGCG TTCAACATTT AGGCCACCAT CGGGCCAGGG GACCAGTGGG TCCCGTCCAG TGCAAGGAGG CAGTGCCTCC TCCCTCCTAA GTATGATTAA TTAATAATGC AGGTAAGCAT GTAGTTCGGC GTCCACATGC GCATGTCGGT ATGTGCCACA GTGGCTAACC GTGTTATTAT GCACATTAGC CAAACGTGTC ATTATTTTAT TATTATTGTT ATTCCGATTT CGTACTCATT TAAATGCTCA TTAATAAAAT CGAACTGCGA AGATTTCGGC AGTTCATTTC GAGTAACCGA ACTTGTTGTG GGCTGGAGTT GCTCCTTTAC CACGAAATCC TCCTTAATAA TAATACTAAT AAAACTTGTG TGGAAACATG CGAATAAATT GATAGTTGAT TTTTATATCG AATATTTTCA TTAAAAAGAA CCAACGTCAG ATTAATGGCA AATTCATTTT TAAAAACTTC AAGTCGAATC TTCTATTTAA ACTTTCCTTA CAATACAGGA ACTAATACAA GTTACCTAAT TGATTTTCCT AAAACTACAC AATGAGTGTA GTCAATGCAA ATAGTGGACC ATATCAAAGC ATTATAGAAA TATGATATTT AAATATAAAG GGATATTATT ACTAAAAAAA AGCGTGTGTC CTAACTTGTT ACTAATAATT ATTATTTTAT ATTTCTTAGT TATAAATAAG GTTTTTAGCC CAGTGCCAAT ATTTTGATGG CAACTGTAGT TTTGCGCACC TTAACAACGA ATGCATCGTA TTAGGCTAGT TTAAAAATAT GAAATTAATA AAGCAAATAC AACATCCTAA GCCAATGTTT TGGTGCACAA ATTATTGATT TTAAAAAAGC GCAGGGAGTT TCCTTTTCGC GATGCCCCTG CGACATTTTC CTATTTTGAA AATAATGGAG GCACGCGAAG GTAGCAGATA ACTAATAGGG CATTACACGG CCAAGATTCA GACATAAACA TCAGAGCCCT TCCACTGAAA TGTATCTGTA TCTGACGAGT GTATCTGAAA CGTGCAAAGA GAGCCTGCTG GCCGCTAAGA GAGCGAAGAG AGCGCGCCAG AGCGAGACGG CACACGCAGA GCAGGACGGC GCGTGAGATA AATAGAGTCG GGGGTGAGTC GAAGATACAT ACCGCCTCGA ACGCGCTGCC TGGGAACTCT GCCAGCATCC CCAAAAGCGA TATGGTATGT ACAGCCCGAG CTGAATGTGT ATTGGGGCTG TTCAGTTGTC GGTGACACGG GGGATTGTAA CTCACTCCCC CTTTTTGGGG CTTATCCGAA GCAGTACCTC TACACTCGGG CAAACGAGTG GGGTAGTTCT TACCTATTGG TACCTGTCGA CGTTAAGCTT ATACCCAAAT AATTTTGATA CCTTCAGATA TGAACGGTAT TTGCCTATCG GAGTATATGC TAGTCTTAAA AAATATGTGT TTATAAAGAT TAGTTTGTTC TCATGCATCT CTTATCTTAA GGTTATCCAA ATATAACTTA AAATAATTAT CTATTAATAT AGCTGTTACT GGAACTGTTA TTTTCCAAGG AGATACCCA