Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT004454
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206327
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 204454
Nearest Genes
Gene Nr FlyBase ID Distance
CG32986 FBgn0052986 8711 bp
CG18024 FBgn0029123 26227 bp
Sequence Length 2247
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGGGCCAATCAAAATAAATGGCTACA
Right Primer TAGGTTTTCCGACCGAGGCACTTGA
Template genomic
Sequence CGGGCCAATC AAAATAAATG GCTACAATAA TCAATCAATT TAAATTTAGG GTGATTATTT TTAAAATGTA ATAGTATAAG TATTAAATGA TATCTAGTTG TTCTTAATGT GGCCAATTTT AAATATTATA CTTACAGGCA CAAGAACGTC CCATTTGTAT AAAATGTGCG TGCTATGAGA ATAGCCGTGC ATGTGCAACC ATAATCCAAC ATTACATGGC TCGGACACCC TTGAAGGTCC TTCAAGAAGT GCTCGTCAGC CGACATGTCC TGAGTCCTTG TCTCTGGCTC TTGGCAGGCT TTTATCAGGC TGTTTTTGCG GTAGAGCAGT CCTGGGTGTG CGGTGTTTGG TATTTGGTGT TTGGTTACAC CACCGCAGTC CAAGTTGGAA GACTTGGCAG AGATGAGAGA CCCTTGGGCT CGGATTCCCG GGTTCGTCGA CTGATGTTGT AAGTAACATA TTGTGCGAGC ATACATACTT ATTTATCGAT GGACGCGTGT CTGTTTATTA ATTGAAGTAT TTGTTCAGTG TGTTGTCGTC ATCGGCGTCG CCGCCTGTCG TCTGTTTGTT TTTCCATGGT TGTTGTTTGT GCGGCGCGTC AACACTTGAA ATTTGAAACA TTCCCACTGC CGCACTTCTT CTTTTCGGGT TCGATCGACT TGCTACTTGT TTACATTAAC CAATTAGCGT GTGGCGGGGG TTGGAATATC AGGTTGGGGG TTAAGACCTT TGACATCGCA TTGACATGTT GCGACTCATA TTTGTTTTGA CAGTTTTCCA TAGTGCGGGG GTGTACGTGT GTGCCACTGC ACAACTGACA CACAAGCCAC TAGAAAACTG TCACTTTAAC CTACGCACTT TCGGAAAACT GTCCTTTCGT CCTATTTGTG TCAGGTGCCC TGCTTCGATT TCAATCTGAA TGTATTATTG GAAATACCTA CGAAAGCTAA AATTATTAAC GTCATTACAT GACAGATGTA TATATGCAAA ACTTTCTTTT TTCACAATAT TACTTAGTTT TGTTTAGAAA GCGTAATTCC ATAAGTTTGT TCAAAGAGTG GCTCGGTAAT TTTCCTTAGC GCTTTGCAGA ATGCGAACCG ACTAAATGGT TGGGAATTTT CCTTTCTCCA TCCTCCTCCA ACTATCTATC TCCCCAACCC AAAACGATGG AATCCCGGTG CCTTGCGGAT TGGTTTTTGT GTTATCAAAA CAAATTGCAC TGCCAGCAGC AGGCGCAGAA TCGCCGAAGA TTGGGGCAGG AAATTTTATT TGGCAACCCC GCCACTTAAC CCGGGCCCCA AAACCCTCCA GAAAAGCAGA ACACTCACCT TTTCGCCCGT CGGGGCCACA TCCCACATAA TGATGATGCG CAAGTGTCGC GTGCACCTTT TTTCCACCCG GATTCTGTGA TGGGGTTGCG GATTGGGGAT GGAGAGCACA GAATACAGGA CTCAGGATGC GATGTATTAG CCGGGGTGGG TGGGGCTGCG GTTGGGCTGG GATGCCTGCA AGGAGATTGG CCATAAAAAT TCCGTAAAGA TAGCGATTTA TGTGGAAAAG GGTTGGCAAG TCGATGCGTA AATTGATGTG GCTTCTGCTG TAATGGCACT TCTCATCTCG GCATCTCTGC AACGCGGCAT CATCAGCATT TGTTGCTGAC ATTTTCGCTA CTTAGTGGGG ATGCGAGATT TCGGAAAGTA TATATATTCT TTTTCTTGTC AATCGTGGGG TCTTTTGTGT GGGGCGCAGT GTGGAAATGA TTTGCAGGTG GTTATTAATC AAATTAATGT GCTTATTGAT AACGGGCTGA ATGGCACGCC GTAATGTTGT CGCCTCGCCA TTGTTGATGT TTGCCGCTTT AAGTGGCCGA CCAGACGAGT GCCTTCAGAC AGACACACAT TTTACAAGCT TTTAAAAACA GATTATCTTA TCCCATCTGA ATGGAACAGG AACAACACGG GGCCGCACTT AATAGAAACC CAATTCCGAA GTTACCAAAT TTACATTCAA ATCAAAACGA AAGCGCCGCC TAGGCGGTGG GGAAAGTGTA GAAGAACCAT TCCGAATCCG AAAACATTGG TAATCATTCC GGTCGACTCT GAAATTGAGA CATCAAATTG GTTAGGGATC TGAGGAAAAA GCCACTTAAA TCACCTCAGA GACAAGCGGC GAGATAACGA GAGTAAAAAA GAAACCACAG GCCTGAATAA CCCGAAAACA AATCAAGTGC CTCGGTCGGA AAACCTA