Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000250
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status suspicious
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206194
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200250
Nearest Genes
Gene Nr FlyBase ID Distance
CG11840 FBgn0031260 0 bp
CG11822 FBgn0031261 0 bp
Sequence Length 597
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCGGGGGTGAAAAGCGAAATG
Right Primer CGCCTTTGTTTCGGATGTACGGTG
Template genomic
Sequence GCGGGGGTGA AAAGCGAAAT GACACGCAGC AGCACACGTC AACAATCTGT GTTATCGGTA CCGCTGGTCA TCGTCTGGGC CTATCGGACG CACCGCAGTA TACCAAAAAT ATACCACCCT CTGTGGTGGG GTCGCACCGC CACCAAACTC CCGAAAAATA TACCAAAACG GTTGAGATTC AAAACTGATA AATCTGATTT GAAATTAGTG AATCCCGAAC TTAGTTTGTG AAAACCTGCT AGCTTATCGA GCTAATTGTT CACCAGTTCT CCTCAATTTA TTAATCATAT GTTTGGCATT TTTGCGAAAC AAAAATAAGT GAAATGGATT TTTAAGTTTA TTTTATGCTG ATATATGTAA ATGCTTTTGA ATTGATTAAG TTCTTAAGAG AACTGACTCT CGAACCTCCC CGAAGTCAGT ACATGTGAGC ACGGCTCCCA CACAAAACCC AAATATGTCG GCTGCTGCTT TATCTGCTGC GTCGGCAGAG GAACACCGAG ATATCGGAGG AGCCTCGGCC ATGTGCCAAG CCGCAAACCG AGCTCAGTTC CCATTCAGAT TTCGAGAGCA CAGCACCGTA CATCCGAAAC AAAGGCG