Vienna Tile Information
VT ID VT056777
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206187
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 256777
Nearest Genes
Gene Nr FlyBase ID Distance
CG3578 FBgn0000179 18329 bp
Sequence Length 2119
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCAAATGCTGTATTTTAGGCGCATTTCTT
Right Primer TTTTTCGTAACCCCCTTCACCTTCG
Template genomic
Sequence GCAAATGCTG TATTTTAGGC GCATTTCTTA GTTAGTAAAG TTTGATAATT TCATTACAAT GAAAATTATG AATACTGATT AAAACGAGAT ATTTGCTTTA GATTAGCTGG GTGGCATAGG CGAATGCAAT TTTCTCTCCG TGCTGCCGAG TTCATGACCC TGCAAAAGGA GGGGGGGGGG GGGACTTGCC CCAAAGTGTG GCATGCAATT GTTGTAAAAG GGGGCGTGGT GAGGCGGCCC ATGGATGAGG AATGGGAGCA AGTGAGATGG GCAGAGAAGG GGAGCCACGA GTGGCTTGTA AAAGTTTTAA GTACTTGTAC CTAGCACACA TATGGAGATT ATGGCAGTGT GTAAGTTGCA ACTTTTTTGC ACGCCACACA CACACACACC ACACTTCGTT GTTCTTGTTT TTACCATTTT TGCTGTTGCA TGCTTGCGAG ACGTGCGAAA AAAAAGCAAC AACCAAATGG CAAAACAGCA AACGGAATTA TTGTTGCCGC TTCTGTTGCC GTTGCCCCAT CATCATCAAT GTCAAAATTA TTGTTTTTCC TGCCGCACAA GAACCCCCCC CCCCTCCACC TCCACCACAC CGGTGGAAAA CACCATGCCA CCCTTTTTCG ACTCTTCATG TGAGTGCCAC TTGAATGTTT TGCGAGTGGA TTTGCATTCA CTTGGCTCGA TTCAATCGGT TTTTGTGCCT GTTTTTAGCG AATTTCGATT TCGATTTCGA TTCATTGATG CAATGATTTG GAGGCTTGTG GCTATAGTTT TTCATTCACA AAAGTTCACA GCACAGCTCC TTCAGAATGA CGTGTATTCC CATAGTCGTC TCAATACGGT GCTCCTACTT CACTTACTTA AGAACTAAAA TTAAATTTCA CTTCAGATTG CACTTGCTCT GCAATTTTTC TCAATTTGTC GCTGGCAATT ATGTCGCTAA AGCAAATAGC GTGAAATCTA TCTTCGTTCT GCTGCTTGTT GCTGTGACTT ATCAATTAAT TGAAATTGCT GTCTAAGCGC AAATAAATAA AGTCTCCCCT CGTTTTCCAC ACCCCTAAAC ATTTGGCGAC ACTTTCAGTG CGAGAAGTCA AGGAAATACG ATTTGAAAAA ATAGGCAAGC CATTGAAAAA AAAAAAAATC TATAAAAAAT GTCAGAAATT ATCAAATGTT GACCCCAAAT GAGAGCAAAA ATAGCATTTC GATGTAGATA GAAGATGGTG CGAGATTGCT TTGATTTTGC CAGTTTTTAG CTAATTGAAA GCGGCAATTT ATTGGCCATT GGAAAGATTC TATAAACACG GACTTAATAG CAGTTATTCT GGGTTTTTAG TCACCGAGAA GAAAATCAAT CATTTTTTTT TTTTTGTATT GTAATATGTT GTGCATGTGA TTAGAAAATA TGACGATGAC TTGTCTTTTT GTACCACATC ATAGTTTCTA ATTGATGTCG GACTTTGTGA CAGGCATGCG ATAATGTGAC AAGACAAAAA TATTTAATGA CACGCCACAG GACACCCACT CTTTCCAAGT TTTTGGAAGT TTTTTTTTTT TTTTTGTGTT TTCGGGATCA GGGGTCAGAC CCTGGGCAAC CGCCTGTCAA AGTTCACTTG TTTAATTTTC ATAAATAAAA ATTTTCCATT TCCTACATAT TTTGTTGTTC CCTTACTCCT TCGATTACTT CCATTTTCGT TTTGGGTAAA AACTCAGCTG ACGGCGACAA AACGCAATCA AAGTGCACTG GCCTGCCCCG GGCCGCCCCC TCCTAACGCC CACCTCCTCG AAGCCGTAGG CTCAATTAAA TGGGCGTGTC CGCCTTCTAG TTTTTTATTT TTCCTTTTTT TTTTTTTGTT CATATTTCCC CACAATGCCA TTAGCGGGCG GGGAAAAGGG GTCAATTGGG GGTTGAGGGC GAAATATTGT TATAGTGCAC ACACAACCCC TGAAGAGCCA CAAGTCCCAC CCACAATACC CCATTTCCCA TTTTCCATTT TCCCTGCTTT GCCATCTTGG AAACGTTTTT CATAATTGTG TTAAAATTGT CGTCCCGCAA AAGGGGGCAG GAAAAATTAT CGATGTGCTA AGTTGACAAA TATGCGAAGG TGAAGGGGGT TACGAAAAA