Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT039549
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 206121
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 239549
Nearest Genes
Gene Nr FlyBase ID Distance
CG17117 FBgn0001235 31432 bp
Sequence Length 2211
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer ACCTCTGCCGAAGCCAAACCGAA
Right Primer TGGTGAAAAATACAGGGACAGCGAGTG
Template genomic
Sequence ACCTCTGCCG AAGCCAAACC GAATTCCATT AGTTTACACA CTATGCACAC TATACTTATA CTCACTCATA AATCGCATCC TTATCACGTT TGTGTACTTC GGGTATTGCG CCCATTAGGT GATTACCGAC CGGCGATACA TGACTAGGTG TTCCATGACC CCCGGCCCCC GAATGGTAGC CGTGCATGCC CACTGTGGCC GCCGCCGCCG CTGCGTGCGT CATGTGCGGA GAGTGGTGCG AGGGGAGGCC CTGCAGTCCG GGCGGCCGGT GACCGGCGTG TGGATCGTAC ATGGCCGCTG CTGCGGCTCC GGAGTCCATG CCGTAGCCGT GTAGGCCATC GTCATACTGT GCGAATGAGA TGGGAACAGA ATGTTGAATT AGTGGGTGTT GAGTAGGGAA TATGCAACCA AAATTGCTGA TTAAAATATT AATACTACTT CATATATGGG TAAAGTAATA TAGCCCTGAG AGTGTTGTTA CCATTTATAT ATAGGAAATA TTATAGATAT GATTGAACTG GGTATTCCGT GATAATGATA CTACTTCTTG CCCTCTCGTT TCTCTGAGTG CAGCCAAATT AGCGGCGACA TGAAATCGTT TATATTTAAA TACATTTTCT AAATTAAAGA CGCTCAAACC TCGAAAAAAG AGAAGAACAA CCCGATGGCC AACAAAAAGC GACGACCTTG TGATTACTTT GCCGCTGCTT CGACATTATA TGGACGTATA CTCATCGCAC ATTTGGCAAC CCATACAGAT GTATCTATAC ATTTCGGTTA CCTTACTTTT GTCTTTCAAC GTTTTTTGCA TATTAATTAA GCGCCAAAAG CAGCAGACAA TTTTGAATAT TATCAGTTAA TCTGGCGAGG CATTTTCGAG TGTGTTTGTA TGTTTGTTGT ACTCTATCTA TCTTAAAGTT GTACAACGTT TTGTGGAGCC GCGCAATTGC AAACAGGTTT TGTGCAACTA CAAAATAATA ATAACACCAA ACAACTGAGA AATGATTTTT CTTATATCCA TCCACACACA CACACACATT CGTACTATAC ATGTGGGTAC TTTTTCTCCT TCTTTTTAAC AAAAGTTCAA CGCGGTGTGT GAGATTTTTA TCATTTGTAC TCAAGTGGCG TCCGTCGGCT GAAGATACAC TTCGCCTCTC CGTTTCACAC TGCATAATTT GAGGGAACAC GAAGAAGTTG ACAAAAGATT TTTGTGCAGC GACAAGAGAT GGCCCAACCC CCCGTTTTGA ACAGCCCCTC ATGGCGAACA AGTTGAGGTT GATTTTTTAT CAGCCTGGAA AAATCTTTGA CACTAAATGA GCAATTGACT TGCCGTTGAG AGAGGACTTT TGAAGTGCAA AAGCCGGGGG CGGTTGGGTT GTTTGCGGAA AATGTCAAGG ATCTGCAGCT GGTAGGGAAG AAGTATCTTT GTATCTATAC TTTGAACTAG TGCAGTGCGC GTCATAACAG CAGCTGGCTT TGCAGGTGGC TTCTTTGAAT AGGCATAAGA ATCGAGTAAG GAGAACAAAA TAAGCTTCTG CAACGACGAT TGTCAACCTC TGAGGTTGAG GCAATCCTTG AGATACAAAC CAGAGATTAG TTTAGTAAGG CGGTCGTGCT GCCTCCGTTT TTCTTCATAG GGTTTTTGTT GCTCTTGCTG GCTGTGTGCA CATGCACGAG ATACAAACTC ATAGATACTA CTATAGCCAC TACAGTATAA GAAACCCAGC AACTTGTCCG GGTTTAGTCA GTTCGTTTTG GCCTGGCTTT TTCGGTTTTT CGCGCTGAGG TTCAGTTCAT GGCTGTTAAA CTATAAAGTT GTTATGCTAA TTTTAGTGTT GGTGGCAACC GAATGCTGCT ATTTTTTCTT ATTTTTTTTC CTTTTTTTAA CCGTTTCGAT TTCTTGGCGT TCGTTTCTTG GTTCGTTTAG AAATGATGAA ATTGTGGAGC AACAAAGAGA TCTTGAAAAT TACCACAATT TGTACTTGTA CATAAGTAAT GTGGGAATTT GAGCCGCCGC CGCGAAGAAG AGGAGCTCAA AATAACAAAA ATACAATGAA GAGTAAAAAT CGAACAGGCA AATACACTTA GGTCCATGGC TTTTTTTTTG TTTTGTGGTA CAACTCCCCG ATCCATTTGG GCCAACTTTG ATTGATGATC TTTGATGGTC GGGTCTCCCT ATCTCACTCG CTGTCCCTGT ATTTTTCACC A