Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT058383
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205982
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 258383
Nearest Genes
Gene Nr FlyBase ID Distance
CG11387 FBgn0004198 38955 bp
Sequence Length 2103
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CAAATGGAAACGGAAGAAAGATGTCGC
Right Primer CGCTTGTGGTTTTTAACACTGCTAATCAGA
Template genomic
Sequence CAAATGGAAA CGGAAGAAAG ATGTCGCGTC AAGAAATGGG ATGAGATAGA TACAAAAAAA AAAAAACAAT GAAGACTTAA AGTAAAGGGC TTAGTATGCA AATTATTGCA GATATGAATG TCAATATTCC TAAATCAAAC AACGATTCGT TTTACAAGGA CCATGCCCAT TAGGTGTCCC CAAAAGTCTA CCAATTTCCC TAATGCAAAA ATAAGACGGC ATCCTTCCCC TGTTTCTTTT TGCAATGCGC ACCGCATTGA ATGATTGCTT ATCCAGAAAA ACCACCCGTG AAAAGCTTTG ACTTGAAGTG TTCCGTGCGG CTTTTTGTGC TGATTCGAAG ACGTGCACTC GGGAGTGGTG CACATTGCAT TTTAGCATCA ATCATTATCA TTTGCCATTA AGTGCAACAG CAGCAGCAGC GGCTTCTCTT CCATTAGCAA CCCCTAGGTG TTGCTGCATA AGAAGAGGGC AAAAGTAAAA AAAAAAGGAG AAGCGCATTT CTTTAATGTT TTATCACTTC ACTTGGCCAG ACAACAACCC AACCACCCAC CACAGAGGCT GGCATGGGAT ATTGGCGCGG GGGCTTGAAG AAATCTGAGT GGTTTTCAAA AAAAAAAGAA ACACATTTTT TGTCGTATAA GAATATACAT TGGTATATTG ATTTCATAAT GGGAGAAAAT ATCACTTAAC CTTTAAATTT TAATCGATAT ATATAAATAA TCCTCACTGT GCACCCCTGG AATTCTGCAT AGATTTGGCT TTTAGCCTGT GTTTTCCTGG CGTTTTGTGC GCGTTTTCTT ATTTGAAATC CATTTAAAGC TATTTTCGCC GCCTGGTGGA GGGCCCAAGC TCATTAGTTT GATTACTGGC GCCCGGGCGA CACCTCTCCA AGACCCCCAC CCACCCCCGA AAATGACTTC CCTTTTGCGA TGCATCATCC CCCCCCCCCC CTGAAACCAA CGTCCATGCA CAGCTGTGAT AAATGCACTC GACTGACAAC TAAATCACTT ATGAGCGCTG CTGTGTGCGT AGATTCAGAT TTATCTGTTA CACATGTTCA TAAATATGCG ACAATATTTT TTTGTCCTCG AAGCGGCGGC AGCCAAAGAT GATCGACAGG AATATGAACG GCGAGGCCCT GGGATATATC TACAGTTGTG GGAAGAATAA TAGTTGTCTC GAATACAAAA ATGTAGGCAC ACACAAAAAA TATACGCAAA AGGATATTCT CGAAATGCAA TTACTTGAAC ATTGCTTTAT AGACTATATT CGAGTGTTCA GTCAATTTTA GAAATGCATT TTGCTTTTCC CACTGCTATT ATTTTCAACA CATTTGTATG GGGCGCAAGT TTTTGCCCAG AAATCATGTT AAATGGAATT GCAACAGTTG TTTGTTGTTA GAGTCGAAGT GCAGCAGCTC CTCACTTGCT GTGCGTTTGT TTTGGCTATG AGGCATGTGT TTATTTTTTC GCAGAAGTGC ATTTTTATAG ACAAAGTGCT TTTGGGCCGC GTCTTGCTTC CAAAAATAAA ACGCATCGAA AATATGAAAA AATATTATCA AAAAACAAAA AACAAAAAAA AAAGGGGAAG AAATACGAAA TGCTTTTTGA CAGAGCAAAC AAATGAACAA CAAATTAGCA GCCAACGCAG CTTCCGCTTC GATTTTGTTT TGTTACTAAT ACTGAGCACA CAATAATTTC AAACAAAAAC GACACGTACG GTGGCAGTTT GTTTTACTTT TTTTTATCAC ACGCCGCAAA CAAAAACAAA CAGCATATGC GGAAAAAACC AGCGAAATAC AATAAATGTA TTTATTAAAT AACATTCACG ATTTCGTTTT TTTTTTATCT GCCTCTACAA AAATGTGTAT GTGTATTACA CATATATATT TATAGAATTT TTTATCGACA TTTTTCGACA TATTTATTTT ATGCACAACA AAAACACCGA CGGAAAAAAG GCCAAGCCCC AAACCAAAAT CAATTTTTTA TCTACGTTGT TTTGCGGCTA GATTTAGTTG TTTATGCTAA CACTATGGCG TAGAAGTAGA AATAAAAATT AAACAAAAAT GTATCTGATT AGCAGTGTTA AAAACCACAA GCG