Vienna Tile Information
VT ID VT056785
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205981
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 256785
Nearest Genes
Gene Nr FlyBase ID Distance
CG3578 FBgn0000179 32383 bp
Sequence Length 2162
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer CAAGTGTTTCAGCAAAAATGGCGCA
Right Primer CAGTAGTTGCGGGTACGGGGAAACC
Template genomic
Sequence CAAGTGTTTC AGCAAAAATG GCGCAAATTC ATGTGTGCAT TTCCGTGTGC GAGTGTGTGT TTCAACAGCC GCAATTATGA GCAATTATAA CAAACAAAAA AAATATAAAC AAAAAAAAAA CAAAGAAACA ATACAAAGGC AGGCAAACAA AAGCGGCGAC AACACCAAAT AAGAATAAAC CAATGCAAGG GGTGGACCTT GTTTGTGTAT TTCTACATAC AGATATATAA TTATCCATAT TGAAATACAC TGCAAACGAC TTTAGCTACT TAAACTGGCG CTTTTAATAC TATAGTTATT GCATAACCCG TCTAATTTGC ATGGAGAGAA AGAATAGATT TTTTTGTAAA ATTTTCTTTT TTTGTTCTTA TAACATTATT TGAACGAAAA TGAATAAATA ACCGCAACAG AGCGCGTGCT TGAAAATCAG TTGTTTTGAT GTTTTTATTT CCCCCCCACT TAATTGGAAA GTGTTGTTTT TGCTGCACTT GTCAAAACGC CACTTGTTGA GGCTGTTCTT TATGTGGCCC ATTCGCAGAC AACATAAATC AACACCCAAA AGTCGACGAG TGGCTGAAAT CCGAGTTTTC AAAGCCTGAC GCCGCGACCC CTGAACCCAT GTCTTTCCTT TCCGCTTATC TGCGTGACAA CTGCATTTCA ATTCATAACA ATTAAGTCGA ACAACAGGCG CGGAAACTGT GAACAGCTAA TAATCGGGGT ACTGAATAAA AAAAAATAAA AAAAAGAAAA AAAAAAAAAC AGATTGAGGG GCGGCGACTG CGAGAATTCT AATCGACGGC AAGGTTAACG GGTTCAGCCA TGTTTTATTT TTTCAATTCT CCCCCCCCCC CCGCCAAAAA AAAAAACAAT ATATGGGGGC TCATACACCT TATCAGGCTA GAAATGTCGC CGCGTTGACA ACTCGACAAT CTAATCGCTA CCCTCGATAA GGATGCGCCA AGTGATGCAA GTGCTATCCA AAGTTCGTAT ACCCTATATA ATTATTTTAA CGTTTCACTA CCTTTCCATG AAAGTTCTTC TTAAAATAGA GCGTAAAATA GCTAAACAAA TTCCGTACAT TATCCATTAT TAGGGCATTG GAAATTCGTT CAGTTTCGGT TGATTTCATC AGCATTGGCT TCGCTCGTTT CACGCTCTCC CAAAATGAAG CGATCAAATT GTAATTACAC CCGATTTCCC ACATTTGATT TATTCATTGC GCCAGATTTA TGCTCAGGGT CAGCGGGCCT TCTTCGATAA GGAATACAGG CGATAGTTTT CCCTATATTC CCTTTTTTTT TTTTAGAATT TTATCCCCTA TACTGAGTTC TTTTCTTCTG CTGGTAATGG TTCTGATGGT GCTGTTGCCC TGCCCCGTGA TCCTGTTTCG GGGTCCCAGA GTTTCGTTTC GGGGCCTCCG ATCTTAATGA CATGGCCATT CATTTCGGGC CAAAACGAGA CGGGAGTGGG CGTTACCACT AACTGACAGG CTAAAACAAA CGGGCAGCGG GTTTACGAGG ACTTGGGGCC GTGGTTATGC CTTCATAAAT TGTTTTATTA TTATATAGAC TTGATATATT GCCCAGCCAC TTGGTCAGTC AGTCTGGGCC TGTCAGTTTA TTGGTTTAAC TAATTTGCCC CGATCCTTCG ACTCTTCTGT GCCTGCGTGA GTGTGTGCGT GTGGGGGTAA TTAACGTTTA TGATGCAGCT GCCTTTTGGT CCTTGTTTGT CGCCGGTCAG TTAGCAAGTT CCCACTGCCG ATGGTGGGTC TCACAAATTT GTCAAATATC GAAACGATGC ACATCTGTAA AATGCAAAAA AAAAAAAAAA ATTTGCATTC CCTTTTCCGC AAGCAATTTG CATGCAATTG TCATTGTCAT TCAATAAAAT TCAAATTAAA TGCAATGCAA AAAGTGGCCA AATAAATAAA TCAACCGAAC CAAAAGACAG ATGTTCTCTA GGCAAATGAT GTAAGATGAT GTTGAATATG CACCCCTTTT CTCAGCTTGT ATCGGAAATC CATTGGCAAA ATGTGTTGAC AAAGATTAAG GAGGCACTCC GAAATAAAAA AAACCGACAG CAATTTTGTT GTCACAAAGC CAAACTGTCA ACGGATCCCC AGCCAGAATT TCTCGAGGGT TTCCCCGTAC CCGCAACTAC TG