Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT022068
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205878
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 222068
Nearest Genes
Gene Nr FlyBase ID Distance
CG3629 FBgn0000157 5104 bp
CG3611 FBgn0035069 8823 bp
Sequence Length 2108
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer ATGAATGGAAGAAAGCCAGCCCA
Right Primer GCCTCCACCTGTCCGCTTACATCAG
Template genomic
Sequence ATGAATGGAA GAAAGCCAGC CCAGTTTGCT GTTTTCCATG CTAAACAGAA GCTGTTCTAC TGCAGCAGCA GTGGCGGCGT CAGGTGAACG CGGACGTGGA TGGGGATGTG GCTGTTTGTG GTGGATGTTG TACGTAAACG CGCCCACTCG GTTACTCCGA TCGGCTGCAA AAAGCGCTCC AAACAGCTAA GACAAAAGTA GGAGTCCAGC CATGGAGTGC CGAAGTTCTT ACTACTCTCT ATCGACATAG TTCGAAGCCC ATAATCTGCC AAATTGAAAA TTCAGAAGAT TAAACAATCA AAGAAATATA TATTGCAACC ATATTTGTGT ATTTCGGTTA TATTGTACAC GCTTCTCATA AAAAGGCATA TACCTCGGTT TCAGGGTATC AAAATAACTG GCTTAAAAAA AGCTAAAAAA AAAAGGTCCT ACCCCGTGGC GTTTTGGCTT TTGATGGGTT GGCTCTGCTG ACTGCTCGGC AGCGGCAACA TGCGGCATGC AGCAACAGCA TCAGCAACGG CAACATGGGG CAGCAGCAAC ATAGTTTACA CACCTACCGA TGCCGCAGTC GAAATGAAGT CGGAGAAGAA GTCGGGGGCT GGGCTCCGTC TGCCGAACCC TCTGGCCAGC AACATGCACT TAACTGGTAG CCACAATGCA CTTTATAATA CCCGGGAACA TGGCTCTCAT CTGTGGCGCG GAGTGGGTAT CTGCCCCTCC TCGCAGTTTG ATAGATGCGG CTGACTCGGA CTCCCGGAGC GATCTACCAG GGGGCGTTGC TGCTGTGCTG CAGTGCAACA TTGGAGGACA GAGTCGCAGT TGAAGCAGCC GAGTAGGAGA GTAGCATAGC AGCAGAAGCT GCACCGTTAG CTGGCTTGGC TTGTGAGCTT GGGCCTCATT TGCATCGGGC CATAAACTCG GTGGCCCAGT TCTCGACGGG CGAACCCGTA TCCGAATCTG CATCCGACTG CGAGTGCGAA TCCGATTGCG AGCCCAATTG AGACGAACTT TGAGCCGGCG CTAGGCAATG GCCTTGGATT AGTTAAATCC GTTCCGTTGC GACCCGCCTA ATCCTTCCTT CCTGCAGGGC ACCTCATTAG CCACACCACC ACCCACCCAG GTAGGGGTAA GGTCAAGGGT TTCCGGGCTA AGGGCTCGGA AGGTGTTTTC GCCGTGTACC AAAATATAAT TAGCGAGCCG GGCAAATCTC TTTTTAATGC CGTCCAGTCA GCGGGGGTGT TCCGATTGAA ATTGGAGCGT AGCCGAAGGA AGTGTGAAAA GTCGATGCAG AATTTCCGAA AACTGAGCCC AGGACGCTGA AGCTGAGGTA GACGAGGCCG GGAATTAAAA GCGCAGCCGC CTCTCATCAT CATCAGCATC ATCCTTAGCA ACGTCCGCAA AACACTCACG CACACAGGGA ATTAAGTTGA GTTCTGGGTT CTGGATACTG GATTCTGGAT TCTGGGCACC GAGGTTCCAG TTCTGAGCTC TAAGTTCCCA GTTTCAAGAC ATGAAAGATG CCGACCGATG CCGAGGATTT TCGATGTGGC GCCGGCCAGT GAGTATAAAT CATATCACTC ACACACAAAA GGCGTGGGAA GGGGTAAGCT GGTATACAGT CCCGCGACCG CAGTCTTTGT TAATTAATTG CCCAGCTCCA GAATAGACAC CTTTTCAGGC TTCGAATTTT TTGAGCCCCG AAGTCACAGC AAACTTTGCA TTTTTCGGAG GCGGAACCAA ATTCAACAAC ATATTTGATA GATTTCAGAA AACCTACGAT TCATAGGTTT CAAGGGGCCT TGCAGATCCA TGTGGCTTCT CTTGCTCCTG CTGGGTCTGC CGATGGAAAC AAACGAAGGA GAGGAGTGCA GAAATGGACT AACTCTCGGA CGCCAGCAGT GCTACCTCCA CGAGGAGATC TTTCTAGCCC ACCACCCTTT GCAAAGTGTC ACAGCCAAGA GGCTCAAGCT TCCCTGGTGG TGCGCCCTCC TAGAAAGCCT CTTCCTGCTC CTGCTGGTGA AGCTGCTCCA GTTGTAGATG AGCCAACATC TCTCTCTCTT TCTCTCTCTC TCCGTAATTG CCGCTGATGT AAGCGGACAG GTGGAGGC