Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000107
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205863
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200107
Nearest Genes
Gene Nr FlyBase ID Distance
CG3696 FBgn0086902 6526 bp
Sequence Length 2252
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GTTGCTGTAGCGGATGTGGGGG
Right Primer CATTACCATGGAGCTAAACGGGCCT
Template genomic
Sequence GTTGCTGTAG CGGATGTGGG GGGCGGTGGC GCGGCGGATA GCCGCCAGGC GGTCCCATTG CACGCGGGTT CGCCGCGGCT GCGGCTGCTG CGGCAGCTGC CGCATCATAA CGGTAATAGG GATCTCTGTG GATCAGAAAA AGAAAACAGT TGGATATACA AAATTTGGTT TCTACTCGCC AACGAAATTG AGTCTATTTT TCCAAAACAT AGGGCTAACA CTCACCCTTG ATGATTTCCG TGAAACATAT TTTGTGCATT TCCATCCATC AGATTTTTTA AACGCAGCGC ACACAGAAAT GTCCGTTACG CGTCGAAAGA CGCGACGCCG CTGCGTTTCA GATTTGGTCG TCAATTGGCT TAATTTTGAT GCTGCTTTCT GCGCGTGGCC GTTGTCAAAA TGTCGGAAGC CTAAATGTAG TCGATAATTG AGAGCCAGAC AATTGCGGAG AAGTTTCACT TCTCAGGGGA TAAGATGTTT GTTCCTCACT TCTCACTTTA CCCCGTGGAT CAGGTCGGTC TCTGGTGTCT CAATCCACCT TCGCCTTATC GATTATGATT ATATATTAGT TGGTTGTTGG TTCTAACTAC TAAGCTTAAT TACAACTGGT GTGCAATTTA ACGTCTTGTT GTTGCTTTTA TAGGGTAAAA GTCATTTGTG TTTCGTGTTT CGCGCACTTC ATGGCCGACC TTTGACATAT TCGCAGTGAA ACACATTCGC TCACAGCTGA AAAAGAACAT TTCAGAAAGA TTTCGAATAA GTTATTGTTA GTACTAATCA ACTTTTTTAA GTTTTTCACG AAAAACGGTA ATTTTTCAAC GAGGAGTAGT GCACATTTCG GTTTTGAGCG TATTTTTAGA GAGCTTTAAT TTAAGTCCGA GTAAGATGCA TATAAAAGGA TATTGATCTG GAAAGAGAAG ACAAAAAGTA TGATGTATAT TTGTTCGTAG GCTTTGTAAA AGTTTTTTTT AACAACATGG GTACATTTAT ACTCTATGAA TGAAAAACAC TTTTCGTTGC AATAGCTCTA ACTTTTAAGG GGAAAAGCTA TACGCTTATG AATATCACAG AAGGGCACAT ATAACGTACA GTTTTACCCC CCAAAATGTT GAGCAATATT GTCCAGATTG TACAATTATT ATTTTGATTC CGCTATTTTA CTTAAAATGA AAGTGCTTAC TAAATAAACG GTTCACTTCT TCTGCTTTGT GATTTTATAG GGAGAGTTGT GAGTGGAGTG TGGGTACGAA TCTTGGGTGA AAATCTGGTG CAGAAAAAAC GAGAAAAACA ATGGCAACTC TATCGATTTT TCGCATTGTC TCAGCGGCTG CTTATAGACG AAAATCTAAA GTAGCAGTGG AAAATCCGCA GAGAGAAAAA AAAAGGCGGG TGGGTTGACT GACTGGTTGT TATTGTTGGA TGCTGCGAGA GACCAAAGAT ATGCAAATGG GCGGCGAAAA GGGGGAGTGG CAGAGAAGTG CTGGGGTGGC AAGGTGTGGT GTCTGTGTTA TGTGTGTGCA AATGGAAAGT GGAAAGATAT AGAGACAAAA CTACTTCGGA GAGTACATAG AGATATGCAC TTACACACAT AGGCAGACAG ACAGACAGAC AACCGAAATT CGGTGTTCAG TGTAGTGTTA TAAATACGAG TGCGAAAGTT AAAGGCAGAG GGAGGGGTTC GGTGTATATC ACTCACACAC TCAAACGGCA CATAATCGGC GAAACTTATG TGGAGTGCCT GACATGGGCT AAGCGGCGGG CTTAACACCG CCCACCCCCC ACCAAACTAT TTGCCTCCCG CACTCACCTA CCCTCGCCGG GACTGGCCCC TTTGTGGGTT TGCCGTGAGT AGTTCGCGCT TATTGGACAA TCATTTAACC AGTCGTCGTC CCCTCTACAC CCTAAGAAAT CCATAGGTAA CTAGTTTTGA TAAAAATCTC AAAACAAGAC CATTTGCGGT CCGAGTTGTA TTAAAAATAA TTAAAACTAC AAAAAATATT TTTATTTGTA TTTAACATTC ATCTTATCGT CCTGCCAGGC AGTAAATATG TAAAATCAGT GCAGTGCAAA TTTTTCTTGC AGTGCCAAAT TGTGTTGGTT CCCTCCAGGT GCTTTGACTT TGCCGTAATC AATTACATTT TGCTTTTGCA ATTTCAGCTA TTTATTTATT TAGTTTCAGC TCTTGCCATT ATTATTAGGT GAGTGGTATG TATGTATGTA CATACACAGG CCCGTTTAGC TCCATGGTAA TG