Vienna Tile Information
VT ID VT045317
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205793
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 245317
Nearest Genes
Gene Nr FlyBase ID Distance
CG18402 FBgn0013984 0 bp
CG6376 FBgn0011766 41080 bp
Sequence Length 2082
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCCACATTTCCCCATTTTCCACCTT
Right Primer GCTGGCAGTGTTTCACGCGATTT
Template genomic
Sequence CCCACATTTC CCCATTTTCC ACCTTCCCGC CCACAAAACC ACTTACCCGT AATATCTCCA CGCCAGTTAT TTGGGAAATA TCTTCCCATT TATCACTATT TCAGTACACC CACAGACCCC CGATCTATTG ATCTGCTTCC GTTGCGGATA CAACACAAAA TCAAAAGCCC GTAAATCGTG GGTGTATCTT TATCTCGTTC TTTTAAAGGG ATATCCCACT TTTAATGTCA ACTTAAGTCA TTAAAGTCTC AACCTGCTTA AGTTGGCATT AAATAATTAA TGTTTATAAA ATGAAAACAT TGTAGAAGCT CCAAACGTTT TTACAAAGTC TCCATTAAAC TAAATTTAAT GGATATCTTA TACATATACC TTAAAGATAA AAAGAAACCC GATTTATAAG GTCACAGTTT GAGCAAATAG TTTGATCAAC TTTTTGGGAT TTGTTTTAGC AAGTGAGAGC TTTAAAATTG TACTGGATAT ATTTGGCTGG TTTACTCAGC ATTTTGGTCA CTCTAATTAC GAGCTCCAAA ATAAAATAAA AAACAGCACT GTCATGACTT TTTGACAACC GCTGAAAGTG TGGTGTCCAC CATACATTAA AAAACAACAC ATTTTCCAAA GTATAACTTT AGAATTATAA AGGTTTGAAA ATCATGACAA GTCAACAGGT GAGTTCAATT TTATTTTTGA AATATTAAAT AAAAAATTGA GTTTTGCAGG TGGTCCTGAA GAGGGGGTGA GAGCAACATA CATATTAAAG CGCCTTTTAA GGAAAAATGT ATGGGTGTTT AATGGAAGTC GACTAAGACA CTTCTTTGAA GTTTATTGTT TTGTTTTTTT TAATAATTTA TACTAATTCT ATAAATATTT AATAAAATTC TATTGAATAG CTCTTATTGA CGCTTGTATG ATTAATTTTA AAACTTACCA AGGACAATAA GGAGACAGTC TTTAGCAATA GTACTAAGTA ATTTCATGAA ATACTATTTT TAATAATAAT GTTAGTTACT CTTTTAGTGC TGGCTTAATT TAATGCAATG GAAAACTTAT CTGTACCACT TTTCAAAATG CGTGCAACAA TAAAAAATAA ACCAGCACAA CAACAACAAC AATAATAAAA CAAAAACCGG CAGCAATCGA AATTCTTTCA TTTCTTTTCC GCCTCTCTTC GCGCAGCCGC TCTCCGCACG ACAGAGAGAC AGAGAGAGAG AGAAAAAGAG AACAATGTTG GCTGCGCCGC TCATTCACAA AACGGAGACG TAAAGCGGTG TGCGAAGAAG AAGAACAACA ACAGCCCAAG ATATGATAGA TATGGAACAA CAACAAAAGG AACAAGAGGA ACCGGGCGGA GAGAGGAGGA GGAGGAGAGC AAAAACAACT TGGCATAAAT TGCTGCTGCG TAGTAATTTC ACGAGTATTT TCCTAGTTAC GTTCTCACTA CTATTATTCA TTTTATTATT ATTTGTTGTT TTTGTTACAT ACCCCTTTGC AACGGTTTTG TTGTCGTGCA TTGTTGATCT AGTTGTTGTT GTGTCACCTA ATTTTTGATT TTTATTTCTA TTTGTATTTT ATTTTGGTAT CGATTTCAAA ATAGAACGAC GCACTTTCCC AGACGCAGGC GTAATTAAAT TTTCTTATGT TTTATTCGCG TGCTTTCTTT TTGCGCCGCA ACTTCACAAC ATGCTGTGTA TATATAAATA ATAGGAGAGC GCGCGTGTGT GTGTGTATGT GTGTGTACAC AAATTTTATT TATTTATTTA CCGTGAATTT TACTCACACA CCCGGACAAG CCGCACTCTC GCCAGCACAC GAGAATCGCC CGCACTTGTA TTTCGTGGAA TTTCTTTAAT TCGAACTCCA CCGACCTCGC ACTATTGCTC TGTATTTTGT ATTTTCGCAC TTTTCATTCA CGAAATGCTG GGGCACATAA TTTCGCCTTG CACAGTATTA GGTATCGGCA ATTCACTGTG GCCTCTATTT GACAGCGATG ATTTTCCGCA CGACGAACAC ACTCACAATT CCAATTCACG GCGACCGCGG CAACGATCTC AACGTTTCGA AATCGCGTGA AACACTGCCA GC