Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000249
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205754
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200249
Nearest Genes
Gene Nr FlyBase ID Distance
CG11840 FBgn0031260 12 bp
Sequence Length 447
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGAAGAACAGGTACAGCCCGAAGAGG
Right Primer TGCTGCGTGTCATTTCGCTTTTCAC
Template genomic
Sequence TGAAGAACAG GTACAGCCCG AAGAGGGCTG CCGACGCGAT CAGCGGGAAG TACATGGCGT CTTTCTTGGT CATCGTGTCC GCCTTCTCGC CCGTTGACTG CAGGGAGTGG GAATTACGGG AAACATGTTA ATGCAGCTTC CGGGCTGAGT CTGCTTCACA TACCTTCTTC AGCTTGTGCA GCTTCACGGA GCGGATGGAG CCGAAGATGA TGGGCAGCAT GGCCATCACC ACCAGGCTGC TGTAGGCCAC CGCCATGCCC TCCGGAGTCG AGGGCTTCTT CTCGCCCGGC GCCGACTCGT TCTTCGGCGC GTTCACATTC TCGATGATGC CCTTCAGCAC CTCCTTAACG GTTCCGATGA CTTCCTCCGC CATGCTGTGC TGTCCAATCC AATCCGTTCC TGAAAATCGC CGGCTTGCGG GGGTGAAAAG CGAAATGACA CGCAGCA