Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT030534
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205723
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 230534
Nearest Genes
Gene Nr FlyBase ID Distance
CG32139 FBgn0042630 1591 bp
Sequence Length 2094
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGTGGTAATATTTTCAAAAGAAACAATGCCG
Right Primer TTGCGCACCAGATGTCAATCGAATA
Template genomic
Sequence CGTGGTAATA TTTTCAAAAG AAACAATGCC GTTGACACAT TTCTTGATCT TTATGTTTAA ATCATCTGTT TTATAAATAG CTAAGCTTCT TAAAATAATC ACCAAGAAAT TATTTAAGTA GCATACATTT AGCATTCTTT GTTTACTTAA GGAGGTAAGT GCGATCCCAT ATTGTACGTA TTGCAAAATG TATATGTATA ATAGGGCTTG TACAAGATAA ACTATTAGTT GCTTGCTTTT ATTAAAGCTA AAGACTTATT AAATTATTTA GAAAATATAA TTTTTTAGGA TTTACAGCCT ATAGTAGATA AAAAGCTACT AAAAAGTTGT TGAGACTCAT AAATCTAAAA CATAAAACTA TTTCTGGATC GTTACGTGTA CTCAATAATT TTGGAATATC CTTGGGTTTA TGAAGTGGCC AACTGTGGTT CGAAACTATT TATCTTTATC TGTCCAATTC GACTGTTTTT TCTCTGCTGC CATATTCCGC AGTCTCTCTT TTTGGCCCTG TTCATTGGCA TTTCTGGCCA TGCAACGCAT CGTGGTCAAT AACTTGCGTT GGGCTATGCG AGGCGACATC TGTACTGCTT CCGGGCATTA CCACTTGGTG TTAAAGTAAA AATTGCCCAA GCATGCGTAT TAAGCATGAA ATTTATATTA AAAGAAAAGG GGGAGCTGGG AACGGGGAGC GGTTAGCAAA GGGACACGCA TATTTGTAAT CCTTATGGAG TGCAAACAAA TTTCTGTGTT GTCAAGTTGC TCTCCATATT TTTGCTCCTC CTTTTTATGT TGCGAATTGG CAGAATACAC TGAGAAAAAT GAATTGATTA TGTTTATTTG TGCCTCCACT CAAGGTATAC GCTAAATTTC ATATTTTGAA AACACTACGC ATATATCAAT TGATATGAAG TTGCATTTAT GTTTGGATTT TTATTTTCGA ACTAATTTAA TTTTGTGATT ATTCTAGTAA TTGAAATGGC AATAAAACCG AAAATGACTA TGTGGACATA ACACTTGTTC CGATGTGGTG CAGTGTCGCA GTTGCAGTAT CAGTTGCACC ACAGGGCCAC CATCCGAATC GACGGTTGCA CCACCAGCTG TGCACAAATT GCACTCCAGA TATTTTTATT TGCTGTGAAT ATGCCAGCTC CTCCTTTTGA TTCGCTGCAC CTCCACGCAG ACCGAAATGC AGCTCCGATA TTTATTTGTA ACGGAAATGT AACCGTTAAA CCCAAAAGCG TGGGTCTTCT CAGGGTGTTA ATCTAGTAGC CTTAATAGAT AACCCACCAG AGGCACCTTA TGTCCGACTC TTTCTCATGG AAATCGAGTG CTGAAGCCGT TCTTCTGTTT CGGACTTCGT ATCGTATCGC AGTAGGAGTA AAATTAACCC GCTGGCCACT TGAGTTTCGG GGGCCATATA GATCCACTCG TAACCCCCGA CCAAGTTGGC CGTGTTGTTG CTGCTTCGCG TTCATTTGTT CATCCGTTTG TTGGTATGTC AAACAAGAAT TATGATCGGC TTAGCCACAT GCTGAGCCCG AGATCTCTCC CCCAGCCATA TTCTTCTGCT CATTCTTTAG CGGCGAAGAG GAGTCTCGCG GTCTGCAGTC TTCCACCTCG TCTTCAACAC AGGTAGAGCT TTAAGTGTCT CCACTTTGTG TTGAAATGTA TCGCGGATAC GCACCGGGTT TTCGGTCCCA GCAGACCCTC CATTCAAAAG TGTCGTCTTG CCCGCCCGCT GCGATCGGAT CTTCTCAGGG CCCTAAGTCG CTGGGCCCCC TAATGTTTGT AATTAAGAAC TTTCACACTC GCAACAATCG CCTCGTAAAC GTGCCAGTGT CTCGATAACC ACATACCCTG CTCCTCCAAG GTTTAGTGTC AAGTTTGTGC CAAGGGCTAT CCAAAGGGCT ATCGAAAAGA AAAAGAACCG ATACAAAGTC AGCTAACCAT ATGTGTGCTG ATACAGCCGG GTATTAATTA GAATTTTTTC ATACTCTTCT TTGGATTATG CCTGTTTTTT TGAGCAAATT TATAAAGCGA ACACAATGGC CAAAAGAATG GCGTAAAAAT ATTCGATTGA CATCTGGTGC GCAA