Vienna Tile Information
VT ID VT007358
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205647
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 207358
Nearest Genes
Gene Nr FlyBase ID Distance
CG4220 FBgn0004858 3211 bp
Sequence Length 2104
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer CCATTTGAAACCCATTTAATTTTCAGCA
Right Primer CAGTTTGCGCGGGCTCATGTC
Template genomic
Sequence CCATTTGAAA CCCATTTAAT TTTCAGCAGA TTACCAGAGC ATTAAGAATG CCGCCGTAAC GGTCAAGCGT TTCCCCTGGA CATTTGGGAA TTATGGGATT TTTTGTTTCA CTCGGTGCCT CGGCTTTAAA ACCAATTTGG GAAAATGTGT AAGGTAAACC ATGTTGTCAC ATGGCGACGC CATAAGCAAG TGCACGGACA TAATTAAGGT CGTTATGGGG GATGCAAGTG ACGAAACCTT TTAAACGAAA TCTTTTTTAA GTAGCAATAA ATACATTTTA AATATTGATT CATGTATATT GCGTACATTT CTTTTGCATT TCAAAATAAC ACGAAAGTAT TGCATATAAC GTATACTTTA AACTTGGCGC AACCCGTTTA GTCGTACAAT TAAGTTTGTG ACACATCTCA TGATGCTGTT AATGGCGATG ATGATAATGC AATTGACAGT TATCAGCGGG CACATTAATT TGATTACTTC TATATGAATT TATTGGTTAA TTTGTTGGAG CCCCCTTTTG CTGGCCACCC CCTTCCACCA AATCGATTAT CTCGGGCCAT AATTTGTAAT GCCGCGACTT AACTCTATGG AGAAAAAAAA AAAATACATA AAAAACGGGT TATTATTTTG CGGTTTAAGC GTCGATTGCA ATTCATTATC ATAGTTGCCG CCTCGCGTGC ATTTAAATGA ATTCATTGAG TTTCACCCAT TCAATTTGTA CATACGCAAG CATTTAGCTT TCAAAATGAT ATTTGCCATG AATGGTTATG ACTATGGTTT TGAATTGAAG GTGGGGTTTT CGGAGGTGTT GCCAGCACGA TTGGATGGGG CCGAGTTTTA ACTGATAAAT GCCGTTTAAT TGTTACCCTA AACGGCAATA ATATTGTTTG TCCGAATCGG AAATACTGCG TTGGACGCTG CTGTTCGAGT TTTATTGCTC TTTCTATTTC TTACTCGATA TTTATAGTTG CTTATTAACG AAATTGGATC GTTAAATTTA TGGTCTCACC ATAAAATGTC ATAAATTTAT TAATGATCTG CCGCAGATAT CGATCCAGTG ACTATATACT TTTTTTTTAA GTCTGTTCCT AATCGGTTTC TTATCGCTCC GCAAACCCAA GTGTTTTCCA GATAATCTAT ATGAAATTCA GTCCAATTGC AATTTCAACA GGCTAAGCTA TTGTTAGACA GATCGATTGA TTGATTTGTT GGAATTTATT GTGCATTTTG ATTTGATTAG GGTACAGTAC ATGATGCATA AATGTGACTA ATGCTTTATT TATAAACGCT GATAAGAGGC AGTCTAAAAA TGAAATGATC CGTTTACTTC AGGCGGGATT TTATCGACTT CCTGAATTTT TTTCATACTA TTAAACGATC ATTGTTATTA TTTAGGCTTA GGAAAATGTA TACACCTCGT GTAAATTGAC TTTTAACCCA GCCCAACCCC AATTAGAGTG CCATAGCAAT TTCGCTGTAC ATCTTGTATC TCGCTTGTCT GTCTCGCATT TCACATATTT AAAATGTTCC AAGAATTAAT TAACACTTTG GACAAAAACT ATTATTTGTG TGCGAGTACA AAAAATTAAC ATGACAGCTC TAGACATGGC AATTTATCAC CGGCATAACA CGTTGGAGCA ACTCTGCTCG ACTCATTTGT TGTAGCCTGT AGCCAGGCAT TTCAGCTGTT GATGACACTT TAATTAGAGC CACACGCAAG CACAAAGCCC AAAGAATGGC CCATTGGGGG CGAAAATTCG CAGGGGAAAG GCCTGAGACG GAGCCGTTAT GTCAAGCGCA CACTTTAACT GCCAGATCCG ACCAGTTGTG TTGGGTTTAT TTGGTGGCCC AAACCAAACC AAACCAAACC AAACCGTACG CTGCCAAGCA GCCTGTGGTT AACTGAAATG AACGTCGGAC TGCATAAATG GCCGCTTGAC TGACACATTT AATTATATTA ATGATGTTTG CGGTCAGCTG ACATTTGCAC TTTATTTACC TTTTTCTGCT GCTCTGTCAG TTTAACTGTC TGTCTGTCCG ACTGACTGAC TGACTGACTG GTCTTGAGCT CATGTTAAGC TCTGACATGA GCCCGCGCAA ACTG