Vienna Tile Information
VT ID VT039484
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205600
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 239484
Nearest Genes
Gene Nr FlyBase ID Distance
CG14680 FBgn0037817 51641 bp
CG17117 FBgn0001235 150128 bp
Sequence Length 2098
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GATCGGTCACGTAGCTGGGGAGTTG
Right Primer CGATTTCCTGGCCTCCGCTTTTATC
Template genomic
Sequence GATCGGTCAC GTAGCTGGGG AGTTGGAGAG CTCAAGAGCT GGAGGTGATG GAGGTACCCA GTCACCAGTC AGCAGTCACC AGTTGAGGTG CCAGTGGCGC AGATCCGTGG CCAAATGTAG CGCCAATTGC TACGCATTTG CGAGCACCGA GGCGCCTATA ACAAATGCCA ATCGTGTCGT GGACGACGCC AGCGATATTT AATTGTTTCT GCGGCGACAA CTTATCGGGG AATTTCGATC GGAATTTTTA ATTTCTGCAA GTCTGCAGTC CCCCATCATA CGTCTCCCAT CCGCACCTCC TCCAATCCTC GTCCAATTCC ATGATGAGTG TCACTGCAGA ATGCATAAAA GGCGGCGATG TTGCTGCTGC TTCTGCTGCT GTGCCTGCAA TATTGCTACC GCTGCTTTAT GCAAATATGA GGTACGGACA AAGAGCAACC AGGCCGGGCT TTTCTGAAAA GTTGGCCAAC TGTAATTACT GGACACCCCT CCAGCTCCAT CTCATCCCTT GCCGTCCCAT ATCCACTGAC AACTTTTTCA CACCTGTTCA AACAAGTTAA TTAACAGCTC GCAAAACTAC TTATTAAAAT AAGAAAAAAA GTAATACAAA TAAAAAACAG CGGGAGAGAG AAAAAGAAAA GACAACAAAC AGACGAGCAG CCTATGGGAA AGTTTCTAAT TAAATGATTG TCATCTCGAC TGCGCAGCGG ACAAATGGAC AAATGGACGC TGACCACCGA GGAGCTATGT ATTTCCGACC AGCTGGATGC CCAGAGTCGG AGGCTGGGGG CTAAAACTCC CAGATTGTAG TGCAAACTTT TGTCATTATG CAGGCAGAAT GCGCGAAACA AAACAAACAG AAAGGTAGCA CAGGGAAAAA ATGGAGAACA TAGTGGACAA CCAGCTGAAA TTATTAGCCA GGCTGAGGGG CAGATGGTCA GCCGTCCACG ATTTACTTAA TCCCAGCACG GAAAGAAAAG TCCGAGGGAT CCAAAAGCCA TAGTTATCAA ATCAAGCTAA CTAAAAGGTA TTTCAAAACT ATGATATAAT CACTACAAAT AGGAAACGAA TTGGAAAATA TTTACAATTG AGTAACCCCA ATATTTTAGC AGTGCATTTT TCGGCTCCGC CAATGAGGTC ATCAGCTCCA ATCACCTCAT ATATCATCTG CAATAAAGCG ATTTTCCCCG AACTCCCCCA CAAAACCCCA TAATATCCAC TCCGAAACGG AGTGTGAATA AAAAAACGAG TGATTCAAAA AAGTCGCTTT GCCTTGGTGG TTGGTTGGCC ACCAAATTGG CGACAAAAAA TTAACGGATT TTGCTGTGGA TTTTTTTTTT TGGTGCCGTG TGTTTGCCAT TCAATTAATA TAACTAATGA AAAAGCTGCT AACTTTGGCC AGGCAACTGG CAACTGCCAG ACGAACTGCG TCTCAATTAA GCCAAATCTC TGGGATCTGC CGTGTAATGA AGTTGCTCAA CGGCCAGTGG ACGGTGTTTT TCTGTTTTCT GCTGCTGCTC TTTAAGGATT GCCAATTTAT GATTGGAGTA GCCGTGTGGG GGAAAAAATG TCAATCTTGT AGATGTAGAT TAGCCGGCAC CAGGTGGGAG CCTTGACCAC TTCGCCTGAT TGGAGCACAC CGCAAATGCC AGACGAAATA AACGAAAATG TCAACATAAT TCTGTGGTCT CTCGTACATT GTACCCAAAA GATCTGGCGG CAATTTATTT GCCTGAAGTG CGAAAAATAA TCACAAATTG ACCGAAACCT TTACGTTTTG ATTTATGACA CATGACCTCT GGAAAGCGTA ATTCAAATTG CTGTGGTATT GACCTTCTTA AAGCTGATGA TGCAAGGTTT TTCAAAGATG TACAAAAATT AATGACAATG TGTTAAAAGA GTTTAATATT TTTTCTCAGA TTTCATTTAG AGCTAGAGTT AGAACAAAAG AGAAACTAGA GAACTGTTTC TAAGCTCCTA TGCCAGCTAT CCAATTGACC TTTATCCGAT TGCCTAAATG CTACTAGGCT TATGCAAATT TCCCAGATGC CGAGTTCACT TTCTTTTCAT TAGGATAAAA GCGGAGGCCA GGAAATCG