Vienna Tile Information
VT ID VT039431
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205598
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 239431
Nearest Genes
Gene Nr FlyBase ID Distance
CG17100 FBgn0259938 0 bp
CG6312 FBgn0020379 10172 bp
Sequence Length 2181
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCCGCCAGCGAGTTTTATTCATTCA
Right Primer CTCAAAGGAGTTGGTTGGGGAGCA
Template genomic
Sequence GCCGCCAGCG AGTTTTATTC ATTCATTTCG ATTCTGTCTC TTGTCGCGAA CAGACGTTTG GGAAATAGTT CGGTGCGGGT GACGTGACAG TGCAAAAATT GAATACAAAA AAATAAGGCA AGAGGGAGAG CAAATAAAAA ACAGCAAAAT TAGCTGGAGG GGCAACAACA AATTTGATAC ATACCTATAT ATACGTGCTT TAATAGTGAA ACACACGCAC ACGCATCACG TTGCTCGCTC GCCCGTACAT ATATTTATAT CGGTGTGTGT GTGTATATAG AGGCGGCTGG TAAAATTCCA CTGTGAAACG AAAGGAAGTT ATTGTTTTCT GTGGCTCTAT TCATGTACCA TATATATTAA CAAAACAAAT AACAGTGTGT GCATAAAATT GATAAAAGCT AAAAACGTGT AAACAAAAAT TAAACAAAAA ACCGCGCAGC GCAATCACGT TTTCCGACAC TATTTGCGTT TCTTCTGTTG TTTTTTGTGT GGATACCGCG AACGAGGAGG AATTGTTCCA ACAAGTGCAC CTTAATTGAA GCTCCAGTAA CAGAAGAAGG AGAAGTACGA AAGAAAAACA GGAGGAGGAG TAAACACGTT ATCGCTATCG TTATCGCACC CAAACACTAG CAAACGCACA CCCAGTGATA AGCGAAAAAG AGTAAACAGG CGGTACACAC TTATCAGCAT TTTTCACTCG TTCCAACATA AATAAACACC CCGCTTCGTA ATGCCCTTCT AAAATTTCGA ATATAAATCC GGGACGTGAA ACGTGAAAAA GTACCCGAAA GAAAAATATC TCATCTCAGC TTTGAAGAGA AAAGTAACTC GCCGCGCAGT GAATTCGCCG CACAGCCGTC GACTCGACAA CCTGTTTGCT CGCCCATAAA TTCGCCCCGG CATTTATCTC ACAATTATTT CTGCACTGAC GTAAGGAGGA GCACTTCCAC CATTCCACCG CAACTGCAGC AAACCACGTC GACGCAGCAG CAGACGCAGC AGGCGCTCCA CAAAACGTTC ACACTGCCCA GGAGCGGATT CGGTGCGTTT CCAGTGCAAG CAGCCGGAGG AGGAGGAGGC GGAGGCGTGC GGAGCGGTTC CGTCTGTGGA TCGAGGAGCA GGAGCCCCAT TGGCACCACC ATGGAGCCCT ATTGGAACGA GACGAACGGA CATGCCGCCC ATCCGGTCAA GTATGAGAGG TAGGTATACT CAGCACAGAT CGCCAGATCC CGCTGCAAGT CGAAAGCAAA TAAAATCCAA TCCAATGACT AAATCGAACC ACTCACTTTC ACCTGTGCGC GTTTAGCTTA AGCACGCAGA GAAAACTTAT CACAAAATGT GCAACAATCC GAAAGCCCTC TCCAATTAGT TGAAAATTGT TAAAGTTTTA TCCGTATCTG AACGACAAAT TAAACCAAAT GAATCTTTCT TAAATAAATA ACAATCCGTA AATTTTTGGA TAAGCATATT GCTAATTTAG ATTCCCAAGA CTTGTGATAC CTTTTCTCTG TGAATTATTT AATGGTTTAG TGTATCTAAG ACTCGCTTCT AGTGGTTAAG CCTAAGTCTC CGCCTCCTCT TCTATAACTC ATAATCGTTA TGTGCGTGCA TGTCAGGATC GGGTGTGGAC CATTCGGATC TGTTTTGGGA TGTGTGGGCC GCGTATTTTT AGCCGTCGAG CTAGAAAGCG TTTTGCATTT GCAAAACAAA CGCGAAAATC GGGCGAAGAA AACGTGGGCA GACACTGTCG AGAGGCTATT CTTGGCCGAG ATGGGTGCTT TAGTTTTGCT TTATTTCATC TTTATTTTTT CGTGTTTGCC AGAAGGCAAA ACACAAAACA AAATCCAACG CACGACTCGC AAAACGTGAT GTTTCGTTGA TTTTTTCCCT GTGAGTCTCC CAATCCCCCC AATCTCCCAT TCCATTGAGT TTGTATTTTT GAACTTGAAT TTCGTTTAAA CGTGTCCGAG CGGAATCAGA AAAAAGTGCG ATTTGCGTTG GTGTGGCCAG AGTGGGGATT AATAATCCAA GCGAAGTGGT GTGGCCAGCG CTGCAAATGA GTAATATAAT CACGGTGCTT AGGGGTTTTA CGCCTGTCTG CTAAATGTCA ACGGCCAAAC GTGGCTATAA ATATCAGTTA ACAACAGCGT GGGTCTATGC TCCCCAACCA ACTCCTTTGA G