Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT029813
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205590
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 229813
Nearest Genes
Gene Nr FlyBase ID Distance
CG10601 FBgn0014343 19891 bp
Sequence Length 2139
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer ACTTCGGGGGAGATGAGTGGCAAG
Right Primer AGTTCTTTGACAAGGGACATGGGCG
Template genomic
Sequence ACTTCGGGGG AGATGAGTGG CAAGGAGCAG GGAGTCGATC GCCTGATCGT CTTAACAACA TGAGCTCTTG TTTACTCGCA TGTGGGTGGA GTGCCTGATG GTTCAGGTTG TGACTTGGCG ATTGTGGTGC TGATGGTACT CGTACTCAAA CTCAAACTCA AACTAAAACC GAAACTCAAA CTTGCAGTGG TGCTGGTGGT GCGAGGAGTC GAGGTTCATT CAACGAGACT GCCACATTTC AATGGCAACC GAGATCGCTG TCGCAGATAC CACAATTCGG ATGTTCCTTA TTGCATGTCG TGATTGCGTC AGCTTGTCTC CAGTGCCTGA AGCTGCTCCT CCAGCTCCAC CAGCTCCACC ATCTCCTCCG GGTGATGCGA AAAATTAAGC GGCAACCAAT CATTGTTGTG TGTAATGCTC GGCCCAATGT TCAAATTGAA AAGTTGTAAA TTATCGAGCA GCACCATCGG AACGGTTCAT TCCAATTAAA TTTGAATCCA GTGTGGTGAC AGCCCGTCGT GACCCCATGG AGCCCACCTC TTCCTGATTG ACTTCACACC TAGGGTTTTG CTCTTATATC CATTCAAATA ACAAATGCTG TTAATAAGAT TAAGTAAGTA AAATAAAAAT AAAAAATCCG CACACAATAT TAGCAGTGTA TCTTGTAGAT TCAACTCAGT TTTCCCTATA ACATTATCGC ACTTCGAATT GCAAACGGCG ACTGATTCGT TTATACTTAA AGTTAATTGA AAGACACATT TTTTTTGTTT TTTTTTTTTT TTGGCCAGCA CGTTTGATTA GGCCATGTTC GGATGAACAC TTTGGGGCAC ATGGACGCGA TAGCTGGGAT AGCAAATTGT TTTACGCTCG AATAAGTGGT ACATGCGGCT ACAAGTTGCT CATGGGGATT TGAGCTGTTG TCAGCGTGAT CGCGCCACAT GAACACGATG GTTCTGTTGA TGTGGATGAT CTTAATCAGT ATCCTCATCC ACTTCCACAT CCACATCCAC TGGGCTCGCT AAGTGGATGC ATACCCATAT CATCGCATTG TCGTTGTCGG ATCGAGCAGT TCTTCTGCCC GAATCTAGAG GGGAAGGGCG GGGCATCTTA GGGATCGGGA ATCCGTAGAG GTGTGCGTCA GATGCTTAAT TTAAATTACC CGAGGGGCGG GACGAGCCAG TCTCCTCGAG CAGCGCACAG CATGAGTAGC TGCGATTTGA CACCTCGACT GACAGCTGGA ATTGGGGAAA ATTATTGAGC GCACTGGAAC ACAAGGGGCG CCCATTAGAT GAAGATGACT TGGCCGTAAA AAGAAAATGA ACAAAAAAAC AAAAAAAAAA AACCAAAAGA AAGAGATCGT CTCAGTGCTA AAGACCTGGC ACAGTTGGAA GTTGGGAGTT GTGAACAGCA GACCACTAAT TTATTCCACA TAAATTAGGC GTATAATTAA AATGTTTAAA CAAGCCGGGG ACTACCATAT ATTGCAGCCT GAAAACGCTG CCACAAGGCG ATAATCAAAT ATTTTGTAAC TCAATCCGCC CATCATTTCA AGTCGGTAGT ACCATTCCGA ATCCCAACCC AATTGTCTGA AACTCAAGCT TTTTAATTAT TATTATGCGC ACTCAGTCGT TATAGGGCTT TATAAATATC TCCCAAATCG GAGGGCTGCC CTTTTTTTTA GTTCGATACT TGGGCCAGTA TATAATCATT AATAATTTGA AAATCATGTC TTTTGTCGCC AAAACATTTA CCGCATCGAA ATGAACATAA AACTGTCATA TATTTGATGA CTTTATATTT ATGAAGGCCA AAAATGTTGA TCGCCAGAAA AACCAGTTGT TTTTACGATT GCGAATTATG ATGAATTCAT ATTCCCCAAC GATCAACGAT GAAAGATGGA CAAGGAGTTT CGATTTGAGT TGGAGGTTGA TTTGAAGTTG GAGTTGGAGT TGGAGTCCCC AGAAATATGA ACGTCGGACT GTCGGGAACA CACAGGCGGT ACGTGCTTTA CATTTGAAAT GATGTCAAGT CAGGCGCACT AATTGATCGC TTTTGGAGCG TGGAATCCTT GGTCCAGGCC ATGTCCGCCG ATCGGGTCGC GATGTTTGGA CCTGCGCCCA TGTCCCTTGT CAAAGAACT