Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT042351
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205544
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 242351
Nearest Genes
Gene Nr FlyBase ID Distance
CG3992 FBgn0003507 2969 bp
Sequence Length 2098
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AAAATTATATAACCCAACAATGGAAGGGACAA
Right Primer TCAGTATTTACCTAGCCGAGCTCCCCA
Template genomic
Sequence AAAATTATAT AACCCAACAA TGGAAGGGAC AATATTTTCC CTGACGTTGT CAGCGAAAAC AAATTCATAA TTCTGTTTAT TTGCTTGGTC CGAGAGCGAA AGGATCTTGA AGGACATCGA AGGGATCGAG GGAACCAAGT GAGCACGAGA TGCGGCAATA ACAATAACAA CCGCATCCCC TGGGTGTCCT GTCTGTTGTC CGCTGTCCCC TTCCCCTTGC CACGATCGAT TTGTATCGTG TCGGCGCGTG TTGCCATTTT GTCCTGTTTA CCGTGCCGCA GGCCACTAAC TATCCGCTTA CCTGGACGGG TCACCCGAAA TGGGAATCCT ACCTGAACGG GCAAATGGCA GCCGTCTGCG GCTTGGCCGG CCGATTAGCG CTGATCATTG CGGCTTAATC GTGGCTTCTT GACAGTTTCC AATACTAACT CTATTTAAAT AGGTTCAATT GACGTTTTTT GTTTGTCCGG CTGTGGGAAA AAACTTCTCT CAAATGTGCA GAAAATATGT TCGGCCAGTC CAGGAAAGTC AGTCGGGGAT TGTTCCAAGC AAAGCCGCTT GACCATATTA CCTAATGATG TGTTTACTTA TTTAATTCAA CGTCACATGC GCCAGTGTTG ATTCTACAAA TTGGATAAGT ATGCCATGTA AATTGTATTT GCATAAAATT GGAAAATTAC TAAGATTGTT AACACTGACA TGTGGGCAAC AGAAAAATCT TTTTTTTCAT ATGTTTGTAT ACCAATGGAC ACTATCATTG AAAAAACAGT GTTTTTTTAG ATATTACTAA AAACTAGTTT AATAATTCCT TAAAATGTTA ATTTTAATCC TTGACTTTAA GAAATCTTTG AACTTAATTT GATCAAATGT GACAAAATCG TTAGTTTTCC CATTCTTGTA TCTCCGCACA GCATCGGAAG ATAACCCGAA ACAATTGAGT CGCTTATTGT TGCATTAAAA GAGTGTTAAA GACATGTTCT CAATGGCCAT TAAATGGGTT TGATAAGAGC ACAACTTTGT GGCAGGCCGC AGGCCACTTG AATCGGATCT GGCCGGTTTA TTGTAGGAGT TTTATTTGAA TGCCTACCAC ATAACGATGC AGATAATTGG CGCTTAAGGA GTCAAACGAC TTGTATCCAA AAGATAGGCG AACACTCAGC ACTCAACAAA GAGCTCTTCA TGAAATGGAT CCGTGGCGTA TTGGATTACC AGCGCAATAT TTATGGCCGC GATGTACACG AAAATATTAA AAATGCATAA ATACATCGGC ACCGAGACTA TGAACGATCA TCGTACATCG TCCTGATATG TGAGACACTC GCCACGCTTG ACACTTGTTT GAGGGGAGTG GAGCGGGGAA CCTGCCCCGG GTAACCCATT TTCGGCCACC ATAAATATGT CAAAATAGTT TGAAGCCAAA CTTAGTGGCA TTAAACCCTG GATTTCGTGA GTACGTGTGC GTTTCACTTT GGTCTCGTGG GATATACAAA TAAGAATGTT CTGTTTGAAT TGGACCTCAG TGGATTTACT AATGTCCCAA TGTATCGTAC AAAACTTATT AAACGACTTT TCGCCATAAA CAATGGCTAT TCGATAGGTA ACCTCCCCCC CTCCGCCAAC AAAAATCAGA GAGCTGTGCC ACGGCCCATT GACAATCGGA GATCGAGTGT GAAAAAGGGC ACCTCCTAGC CCGCAGACCC ACAAGATTAT CCTTTCCCAA GGACTTGTAA TAAATCACAT CATTAGCATA GCATCTCCTA GTGATTTATC GTTTCGGGAG ATCGCTCTGG AGCAAGATCC TCATGTTTGT TGACACTGCA CATGCTCCTC CGAATCCCCC ACACACTCAT CTGAATTGTC CGATCTGCGG ATCTTTTCGA AGGGCGGGGC ACTCAGCCCT GACTCACATT TAAATGCGTA GTTCTTCACC ATAGTCTAGT GGCTTTAAGG CCGCCTACCG TTATTTGCAT GTGTACTCAA TGCATTTCGT TTATAGAAGC CCGACTTATC AGACCTAACT AAGCATAACA TTGCCAGCTT GGGGTCACAG GCAAAAGAGG GTCAAATCGG ATGGGGAGCT CGGCTAGGTA AATACTGA